Question

In: Civil Engineering

(b) Answer the following in relation to flow through orifices. (i) Explain why the coefficient of...

(b) Answer the following in relation to flow through orifices. (i) Explain why the coefficient of contraction is included in the discharge equation for flow through a small orifice. [3 marks] (ii) If a small orifice meter with a diameter of 0.016 m discharges flow at a rate of 6 x 10-4 m3 /s under a head of 1.6 m, what is the value of the discharge coefficient? [2 marks] (iii) Explain the hydraulic difference between a small orifice and a large orifice. [2 marks] (c) A 55m long dam wall holds back water that is 175m deep. Calculate: (i) The hydrostatic force exerted by water on the dam. [1.5 marks] (ii) The overturning moment generated about the dam base. [1.5 marks] (d) A block of an unknown material weighs 9.5 N in air and 8.9 N when submerged in water. What is the density of the material? [5 marks]

Solutions

Expert Solution


Related Solutions

(b) Answer the following in relation to flow through orifices. (i) Explain why the coefficient of...
(b) Answer the following in relation to flow through orifices. (i) Explain why the coefficient of contraction is included in the discharge equation for flow through a small orifice. [3 marks] (ii) If a small orifice meter with a diameter of 0.016 m discharges flow at a rate of 6 x 10-4 m3 /s under a head of 1.6 m, what is the value of the discharge coefficient? [2 marks] (iii) Explain the hydraulic difference between a small orifice and...
(b) Answer the following in relation to flow through orifices. (i) Explain why the coefficient of...
(b) Answer the following in relation to flow through orifices. (i) Explain why the coefficient of contraction is included in the discharge equation for flow through a small orifice. [3 marks] (ii) If a small orifice meter with a diameter of 0.016 m discharges flow at a rate of 6 x 10-4 m3 /s under a head of 1.6 m, what is the value of the discharge coefficient? [2 marks] (iii) Explain the hydraulic difference between a small orifice and...
For each relation below, determine the following.(i) Is it a function? If not, explain why not...
For each relation below, determine the following.(i) Is it a function? If not, explain why not and stop. Otherwise, answer part (ii).(ii) What are its domain and image? (a){(x, y) :x, y∈Z, y- 2x}. (b){(x, y) :x, y∈Z, xy- 0}. (c){(x, y) :x, y∈Z, y-x2}. (d){(x, y) :x, y∈Z, x|y}. (e){(x, y) :x, y∈Z, x+y= 0}. (f){(x, y) :x, y∈R, x2+y2= 1}.
a) outline the flow of filtrate through the nephron. b) outline the flow of blood through...
a) outline the flow of filtrate through the nephron. b) outline the flow of blood through the nephron. c) describe the properties of the ultrafiltrate of plasma
Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse...
Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse and 3'-->5' it goes forward.......I got lost after this. Please explain. Will give a thumbs up. ----- Which of the following sets of primers could you use to amplify the target DNA sequence below, which is part of the last protein-coding exon of the gene involved in cystic fibrosis? 5’- ggctaagatctgaattttccgag … ttgggcaataatgtagcgcctt - 3’ 3’- ccgattctagacttaaaaggctc … aacccgttattacatcgcggaa – 5’ a) 5’ GGAAAATTCAGATCTTAG...
the cash flow cycle______. a. describes the flow of cash through a company. b. illustrates that...
the cash flow cycle______. a. describes the flow of cash through a company. b. illustrates that profits and cash flows are the same. c. reminds a financial manager that profits are important. d. focuses on financing activities only.
What is the relation between stoichiometric coefficient with molar ratios and weight ratios respectively?I WANT A...
What is the relation between stoichiometric coefficient with molar ratios and weight ratios respectively?I WANT A VERY DETAILED ANSWER.
PLEASE explain why each answer of the following questions is correct, I need to understand it...
PLEASE explain why each answer of the following questions is correct, I need to understand it . 1)Economy is at its long run equilibrium. Assuming all else equal, stock market collapses and consumer sentiment level deteriorates. Which of the following is incorrect? A. In short run, output level decreases and price level decreases. B. In long run, output level is back to its long run output level. C. In short run, short run aggregate supply decrease. D. In long run,...
Answer all questions. Explain what each of the following is in relation to thermocouples: (a) extension...
Answer all questions. Explain what each of the following is in relation to thermocouples: (a) extension leads, (b) compensating leads, (c) law of intermediate metals, (d) law of intermediate temperature.
In relation to Pregnancy kit, answer the following: A- Explain how pregnancy kit is considered as...
In relation to Pregnancy kit, answer the following: A- Explain how pregnancy kit is considered as a “biosensor” technology? (1%) B- What is the biological sample required for test: blood serum, blood plasma, saliva, urine? (1%) C- What is the name and the nature (protein, carbohydrate, nucleic acid?) of molecule that this pregnancy kit is detecting? (1%)
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT