Question
In: Civil Engineering
(b) Answer the following in relation to flow through orifices. (i) Explain why the coefficient of...
(b) Answer the following in relation to flow through orifices. (i) Explain why the coefficient of contraction is included in the discharge equation for flow through a small orifice. [3 marks] (ii) If a small orifice meter with a diameter of 0.016 m discharges flow at a rate of 6 x 10-4 m3 /s under a head of 1.6 m, what is the value of the discharge coefficient? [2 marks] (iii) Explain the hydraulic difference between a small orifice and a large orifice. [2 marks] (c) A 55m long dam wall holds back water that is 175m deep. Calculate: (i) The hydrostatic force exerted by water on the dam. [1.5 marks] (ii) The overturning moment generated about the dam base. [1.5 marks] (d) A block of an unknown material weighs 9.5 N in air and 8.9 N when submerged in water. What is the density of the material? [5 marks]
Solutions
Ally Wells answered 11 months agoRelated Solutions
(b) Answer the following in relation to flow through orifices. (i) Explain why the coefficient of...
(b) Answer the following in relation to flow through orifices.
(i) Explain why the coefficient of contraction is included in the
discharge equation for flow through a small orifice. [3 marks] (ii)
If a small orifice meter with a diameter of 0.016 m discharges flow
at a rate of 6 x 10-4 m3 /s under a head of 1.6 m, what is the
value of the discharge coefficient? [2 marks] (iii) Explain the
hydraulic difference between a small orifice and...
(b) Answer the following in relation to flow through orifices. (i) Explain why the coefficient of...
(b) Answer the following in relation to flow through
orifices.
(i) Explain why the coefficient of contraction is included in
the discharge equation for flow through a small orifice. [3
marks]
(ii) If a small orifice meter with a diameter of 0.016 m
discharges flow at a rate of 6 x 10-4 m3 /s under a head of 1.6 m,
what is the value of the discharge coefficient? [2 marks]
(iii) Explain the hydraulic difference between a small orifice
and...
For each relation below, determine the following.(i) Is it a function? If not, explain why not...
For each relation below, determine the following.(i) Is it a
function? If not, explain why not and stop. Otherwise, answer part
(ii).(ii) What are its domain and image?
(a){(x, y) :x, y∈Z, y- 2x}.
(b){(x, y) :x, y∈Z, xy- 0}.
(c){(x, y) :x, y∈Z, y-x2}.
(d){(x, y) :x, y∈Z, x|y}.
(e){(x, y) :x, y∈Z, x+y= 0}.
(f){(x, y) :x, y∈R, x2+y2= 1}.
a) outline the flow of filtrate through the nephron. b) outline the flow of blood through...
a)
outline the flow of filtrate through the nephron.
b) outline the flow of blood through the nephron.
c) describe the properties of the ultrafiltrate of
plasma
Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse...
Please explain why B is the correct answer, I know on the
5'---->3' it goes reverse
and 3'-->5' it goes forward.......I got lost after this.
Please explain. Will give a thumbs up.
-----
Which of the following sets of primers could you use to amplify
the target DNA sequence below, which is part of the last
protein-coding exon of the gene involved in cystic fibrosis?
5’- ggctaagatctgaattttccgag … ttgggcaataatgtagcgcctt - 3’
3’- ccgattctagacttaaaaggctc … aacccgttattacatcgcggaa – 5’
a) 5’ GGAAAATTCAGATCTTAG...
What is the relation between stoichiometric coefficient with molar ratios and weight ratios respectively?I WANT A...
What is the relation between stoichiometric coefficient with
molar ratios and weight ratios respectively?I WANT A VERY DETAILED
ANSWER.
PLEASE explain why each answer of the following questions is correct, I need to understand it...
PLEASE explain why each answer of the following questions is
correct, I need to understand it .
1)Economy is at its long run equilibrium. Assuming all else
equal, stock market collapses and consumer sentiment level
deteriorates. Which of the following is incorrect?
A. In short run, output level decreases and price level
decreases.
B. In long run, output level is back to its long run output
level.
C. In short run, short run aggregate supply decrease.
D. In long run,...
the cash flow cycle______. a. describes the flow of cash through a company. b. illustrates that...
the cash flow cycle______.
a. describes the flow of cash through a company.
b. illustrates that profits and cash flows are the same.
c. reminds a financial manager that profits are important.
d. focuses on financing activities only.
Answer all questions. Explain what each of the following is in relation to thermocouples: (a) extension...
Answer all questions. Explain what each of the following is in
relation to thermocouples: (a) extension leads, (b) compensating
leads, (c) law of intermediate metals, (d) law of intermediate
temperature.
In relation to Pregnancy kit, answer the following: A- Explain how pregnancy kit is considered as...
In relation to Pregnancy kit, answer the
following:
A- Explain how pregnancy kit is considered as a “biosensor”
technology? (1%)
B- What is the biological sample required for test: blood
serum, blood plasma, saliva, urine? (1%)
C- What is the name and the nature (protein, carbohydrate,
nucleic acid?) of molecule that this pregnancy kit is detecting?
(1%)
ADVERTISEMENT
ADVERTISEMENT
Latest Questions
- Why is it okay to speculate on Currency?
- What is the budgeting cycle and master budget? Why should companies use a master budget?
- please i need to have good answers and easy to understand This exercise refers to the...
- (1 point) Find y as a function of t if y′′+25y=0, y(0)=4,y′(0)=6. y= ?
- What are the six steps of hypothesis testing? What does it mean if we reject the...
- Consider the following network of a project consisting of 7 activities with a scheduled project duration...
- In 1941, President Roosevelt spoke about the “four freedoms.” For many in the country, however, these...
ADVERTISEMENT