The cost of capital represents the weighted average cost of all sources of long-term financing to the firm, is normally the discount rate to use in analyzing an investment, is based on the valuation techniques from the previous chapter and is applied to bonds, preferred stock and common stock.
What does this mean?
In: Finance
1. The given mRNA sequence is transcribed from the gene below it.
5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’
3’ TGAAGCATATTAGTACCGATGTCGAAGCTTGAGTACGTCCCGGTGGGCTAATGGTACATTCAATGCGT5’
5’ ACTTCGTATAATCATGGCTACAGCTT CGAACTCATGCAGGGCCACCCGATTACCATGTAAGTTACGCA 3’
Within the double-stranded DNA above:
a. Which strand ( top / bottom ) is the coding strand?
b. Circle the -10 promoter element.
c. Underline a single nucleotide indicating the transcription start site.
d. Circle the translation start and stop codons.
e. What is the amino acid sequence encoded by the mRNA given? Don’t forget that there is always some 5’ untranslated region encoded in the mRNA. Give the N and C ends of the protein.
In: Biology
When 0.601 g of biphenyl (C12H10) undergoes combustion in a bomb calorimeter, the temperature rises from 26.1 ∘C to 30.3 ∘C.
Find ΔErxn for the combustion of biphenyl in kJ/mol biphenyl. The heat capacity of the bomb calorimeter, determined in a separate experiment, is 5.86 kJ/∘C.
In: Chemistry
A block of copper, of unkown mass, initially at 75.7 celcius is immersed in a beaker containing 125.5 g of water at 20.7 celcius. At thermal equilibrium, the final temperature is 24.2 celcius. What is the mass of the copper if the specific heat capacities of water is 4.18 J/(gC) and copper is 0.385 J/(gC))
In: Chemistry
For the following reaction between Mohr\'s salt (iron as FeSO4(NH4)2SO4
In: Chemistry
1.Use the principles of classical and operant conditioning to explain how you would teach the baby to become just like Sherlock Holmes – a clever and successful detective, rude, with no interest in relationships. Explain at least five ways you would manipulate the environment to shape the baby to become like Sherlock Holmes.
2.To what degree do you think these conditioning principles alone shape personality, and what problems might you expect with this approach on humans?
In: Psychology
New Cities
A regional economy has 11 million workers and an urban utility
curve u(n)=15+12n-n^2, where n is the number if workers in
millions. Initially, all 11 million workers are in a single
city.
a) Suppose the regional government establishes a new
city with 1 million workers, leaving 10 million workers in the old
City. Predict the new equilibrium distribution of population
between the two cities. Illustrate.
b) Suppose the regional government provides a subsidy to the
residents of the new city. The subsidy (in utils) is s=12-2n, that
is, 10 utils in a city with 1 million workers, 8 utils for 2
million workers, and so on. Predict the new equilibrium
distribution of population between the two cities. Illustrate.
In: Economics
The equilibrium constant, K, for the following reaction is 10.5 at 350 K.
2CH2Cl2(g) CH4(g) + CCl4(g)
An equilibrium mixture of the three gases in a 1.00 L flask at 350
K contains 5.09E-2 M CH2Cl2, 0.165 M CH4 and 0.165 M CCl4. What
will be the concentrations of the three gases once equilibrium has
been reestablished, if 3.82E-2 mol of CH2Cl2(g) is added to the
flask?
[CH2Cl2]
=
M
[CH4]
=
M
[CCl4]
=
M
The equilibrium constant, K, for the following reaction is 1.29E-2 at 600 K.
COCl2(g) CO(g) + Cl2(g)
An equilibrium mixture of the three gases in a 1.00 L flask at 600
K contains 0.192 M COCl2, 4.98E-2 M CO and 4.98E-2 M Cl2. What will
be the concentrations of the three gases once equilibrium has been
reestablished, if 2.93E-2 mol of Cl2(g) is added to the flask?
[COCl2]
=
M
[CO]
=
M
[Cl2]
=
M
In: Chemistry
please make sure that it's free plagairsm and no grammer mistakes
In: Operations Management
How would you describe the complexity of the health industry in terms of workforce, environment, and social expectations? How would a health leader successfully navigate this complexity?
In: Biology
A projectile (from the ground) is thrown at a vertical wall that has a height of 15 [m] and is 150 [m] away. If the initial velocity of the projectile is Vo = 50 [m / s], find the shooting angles needed for the projectile to pass 10 [m] above the top of the wall. Calculate the maximum height reached by the projectile in each case.
In: Physics
In: Biology
How many integers from 1 to 500 inclusive are
(a) divisible by 6, but are divisible by neither 8 nor 10?
(b) divisible by 6 or 8, but are not divisible by 10?
(c) divisible by 6 and 8, or are not divisible by 10?
In: Computer Science
PROBLEM 5: Code for the Ages Function Name: goldenAges()
The coding language is Jes Python
Parameters: ● list1: a list containing the names of the TAs ● list2: a list containing the ages of the TAs
Return Value: none
Description: I have to concede defeat. It's pretty hard to be creative and reference memes when working with File I/O, so you guys will get to learn something about us you might not already know: our ages!! For this problem, write a function that takes in two lists and writes to a file called "TAages.txt". The function should match the ages to the correct TA and write sentences which say how old each TA is on separate lines. The TA names should be written to the file in reverse order, and the ages written in the same order as your parameter. Remember to close your file at the end!
Test Cases: >>>goldenAges(["Genevieve","Tanya","Khalil","Ryan","Christina"],[19,21,22,21,19])
In: Computer Science
Create a new C# project in Visual Studio. The purpose of this application is to allow the user to open a data file of their choice and your program will retrieve the contents and display them in a ListBox on your Form. Your Form will need an ‘Open’ Button to begin the process, as well as an OpenFileDialog control to allow the user to pick a file of their choice. The OpenFileDialog control should start the user in their ‘C:\’ drive, and should be pre-filtered to only show text files (*.txt). You will also need a ListBox to display the file contents, and the usual Reset and Close Buttons. Be sure to test the application with your own text file. The file you generated in Assessment might be a good choice, but realize I will check it with my own file, which might hold more than just a series of numbers. Since you don’t know the contents of the file, or how many lines there are, make sure that your ListBox is wide enough to handle content as wide as 150 characters per line without horizontal scrolling, and that your file-reading code has the appropriate data validation to determine if the user picked a file or not, and to read *all* the contents of the chosen file, no matter how many lines there are, without going over the end of the file.
In: Computer Science