Question

In: Biology

You work in a laboratory where genes from viral pathogens are characterized to develop tools that...

You work in a laboratory where genes from viral pathogens are characterized to develop tools that allow rapid and sensitive identification. In your particular case, you have been commissioned to study the p74 gene of the baculoviridae virus family. In particular, you have to try to increase the number of known gene sequences, especially with respect to indigenous baculoviruses and develop a kit to accurately identify the presence of the virus in field trials (phenotypically affected insects). From the search for published sequences, you did a multiple alignment to analyze conserved areas during evolution.

Thanks to the previous design, you can obtain fragments corresponding to the p74 gene of all the baculoviruses studied, some of them not characterized. This has helped you develop specific probes that allowed access to much of the sequence of these genes. Now your intention is to achieve a methodology that allows you to typify the different viral variants.

a) Design the minimum number of primers that allow you to identify with certainty each of the viral pathogens by PCR (AcMNPV, BmMNPV, SIMNPV, SloMNPV, XnGV, CIMNPV, OpMNPV, LdMNPV)
b) State how you would do the PCR reaction
c) Indicate the appropriate controls to verify that your design is specific and sensitive

Solutions

Expert Solution

Answer a:)

Primers for the given virus are special primers in which some are given below:

AcMNPV (The Autographa californica nucleopolyhedrovirus) primers are 5′ pp31 flank primer (5′-GGGGTACCGCCGATAAAGAAGGTGTGCCCG-3′) and 3′ pp31 flank primer (5′-GGGGTACCATGGTAAACGTGCCGGAGC-3′).

BmNPV primers are ORF101UF (AGAATTCGTGCTGAATTAATTT) and ORF101UR (CGGATCCTTAGTCGGTCGATAA).

Primers are specific for each virus and need to develop by buying from the owner or by pre-ordering. Therefore, many scientists do not disclose primer sequences.

Answer b:)

The primers using amplification can be performed by this program. Denaturation at 95 °C for three minutes, trailed by repetitions in 44 cycles of 95 °C for 10 s, annealing 60 °C for 30 s, and 95 °C for 10 s.

Answer c:)

A positive control should include a known result in which a primer should amplify the content of the PCR tube. A negative control should place to show no results in the PCR.


Related Solutions

Most viral pathogens have at least early and late genes. Explain the difference between the two...
Most viral pathogens have at least early and late genes. Explain the difference between the two types, and give one example of each for a specific viral pathogen (you don’t have to give the gene number, only a description of the purpose of the gene)
mutations that can impact virulence? examples of pathogens/virulence genes where each type of mutation process is...
mutations that can impact virulence? examples of pathogens/virulence genes where each type of mutation process is important for evolution?
How are genes analyzed? What bioinformatics tools could you use? How is a comparison between genes...
How are genes analyzed? What bioinformatics tools could you use? How is a comparison between genes (sequences) made? How is the molecular weight of genes estimated? Isoforms how do you evaluate if there are any? How can genes be identified with bioinformatic tools?
Transmission of pathogens from animals to humans typically occurs in situations where humans are consuming bushmeat,...
Transmission of pathogens from animals to humans typically occurs in situations where humans are consuming bushmeat, illegally trading endangered animals, and/or entering into wild habitats. Why is an understanding of animal diversity and issues of animal trafficking critical not only for the conservation and preservation of animals and natural habitats, but also essential for global human health? Discuss this in terms of COVID 19, Ebola, and AIDS. In your answer include information on the following: a) What vertebrates are believed...
You are working in a laboratory where you are investigating pieces of an asteroid that have...
You are working in a laboratory where you are investigating pieces of an asteroid that have been brought to earth. You are taking every safety precaution (hazmat suit etc…) as it is thought that the asteroid pieces contain bacteria-like microorganisms from another planet. Indeed, when you look under the microscope at the pieces of rock you see tiny bacteria-like microorganisms. These microbes double in number every few hours when you culture them in a liquid broth. You decide to see...
If you were to develop an accounting conceptual framework from scratch, where would you start and...
If you were to develop an accounting conceptual framework from scratch, where would you start and how would you structure it?
list five mechanisms of Antibody to protect us from pathogens and explain how each mechanism work
list five mechanisms of Antibody to protect us from pathogens and explain how each mechanism work
Give two examples from you work or personal life of how you would use statistical tools...
Give two examples from you work or personal life of how you would use statistical tools to help with identifying and verifying causes to aproblem . you can read Chapter 8 of the Lean Six Sigma Pocket Toolbook and answer .
You work in a laboratory that studies the molecular biology of tribbles. [Although tribbles are an...
You work in a laboratory that studies the molecular biology of tribbles. [Although tribbles are an alien life form, assume here that the molecular biology of tribbles is identical to that of eukaryotes on Earth.] Your lab has a genomic library of tribble DNA, as well as a cDNA library made with mRNA extracted from whole tribbles. The lab also has a collection of live tribbles that can be used to isolate RNA or DNA, and a supply of fixed...
1.) What kinds of drugs would you develop to combat viral infections? 2.) Frederick Griffith used...
1.) What kinds of drugs would you develop to combat viral infections? 2.) Frederick Griffith used mice and a pneumonia causing bacterium to demonstrate that dna is the basis of transformation. why is it called transformation not conjugation or transduction?
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT