Question

You work in a laboratory where genes from viral pathogens are characterized to develop tools that allow rapid and sensitive identification. In your particular case, you have been commissioned to study the p74 gene of the baculoviridae virus family. In particular, you have to try to increase the number of known gene sequences, especially with respect to indigenous baculoviruses and develop a kit to accurately identify the presence of the virus in field trials (phenotypically affected insects). From the search for published sequences, you did a multiple alignment to analyze conserved areas during evolution.

Thanks to the previous design, you can obtain fragments corresponding to the p74 gene of all the baculoviruses studied, some of them not characterized. This has helped you develop specific probes that allowed access to much of the sequence of these genes. Now your intention is to achieve a methodology that allows you to typify the different viral variants.

a) Design the minimum number of primers that allow you to identify with certainty each of the viral pathogens by PCR (AcMNPV, BmMNPV, SIMNPV, SloMNPV, XnGV, CIMNPV, OpMNPV, LdMNPV)
b) State how you would do the PCR reaction
c) Indicate the appropriate controls to verify that your design is specific and sensitive

Answer 1

Answer a:)

Primers for the given virus are special primers in which some are given below:

AcMNPV (The Autographa californica nucleopolyhedrovirus) primers are 5′ pp31 flank primer (5′-GGGGTACCGCCGATAAAGAAGGTGTGCCCG-3′) and 3′ pp31 flank primer (5′-GGGGTACCATGGTAAACGTGCCGGAGC-3′).

BmNPV primers are ORF101UF (AGAATTCGTGCTGAATTAATTT) and ORF101UR (CGGATCCTTAGTCGGTCGATAA).

Primers are specific for each virus and need to develop by buying from the owner or by pre-ordering. Therefore, many scientists do not disclose primer sequences.

Answer b:)

The primers using amplification can be performed by this program. Denaturation at 95 °C for three minutes, trailed by repetitions in 44 cycles of 95 °C for 10 s, annealing 60 °C for 30 s, and 95 °C for 10 s.

Answer c:)

A positive control should include a known result in which a primer should amplify the content of the PCR tube. A negative control should place to show no results in the PCR.