Question

In: Biology

Transcriptional initiation at defined sequences in DNA is required to ensure that the 5' end of...

Transcriptional initiation at defined sequences in DNA is required to ensure that the 5' end of the RNA transcript is correct. Describe the two types of experimental approaches that have been used to identify regulatory DNA sequences located near gene start sites.

Solutions

Expert Solution

Regulatory DNA sequences near gene start sites can be identified using the following approaches:

1. Mutating the regulatory sequences and then checking the binding of the RNA polymerase or other transcription factors using invitro technique EMSA and in-vivo technique chromatin immunoprecipitation. Using these techniques one can find out whether mutating or removing the regulatory DNA sequence abrogates the binding of necessary transcription factors for initiation of transcription.

2. Some part of the DNA sequence near the start site can be fused to a reporter gene. Many constructs can be made for this fusion by mutating several residues of the regulatory DNA and then reporter assay can be performed for all the constructs to find out or identify the regulatory sequence. Reporter genes such as GFP, YFP, or mCHERRY can be used or otherwise yeast one hybrid beta-galactosidase assay can be utilized for this.


Related Solutions

1. Thoroughly explain transcriptional initiation and elongation in eukaryotic cell
1. Thoroughly explain transcriptional initiation and elongation in eukaryotic cell
preparation of adjusting entries at the end of the financial year is required: a. To ensure...
preparation of adjusting entries at the end of the financial year is required: a. To ensure that cash inflows and cash outflows are accurately measured b. To correct errors made during the year in the accounts c. To provide for the correct recognition of income and expenses for the period d. To achieve accurate reporting of all expenses paid at balance date e. To eliminate the need for closing entries to be made in the accounts preparing the financial statements...
Briefly describe the strategies of DNA binding proteins to ensure their DNA binding specificity. (5 marks)
Briefly describe the strategies of DNA binding proteins to ensure their DNA binding specificity.
Briefly describe the strategies of DNA binding proteins to ensure their DNA binding specificity. (5 marks)
Briefly describe the strategies of DNA binding proteins to ensure their DNA binding specificity.
what does it mean for DNA to be transcribed at a transcriptional level?
what does it mean for DNA to be transcribed at a transcriptional level?
A) Describe the differences between expressed sequences and not expressed DNA sequences and how to study...
A) Describe the differences between expressed sequences and not expressed DNA sequences and how to study them. For example, cDNA vs genomic libraries and RT PCR vs PCR- B) Restriction cutting DNA, running gels, and ligating DNA to make recombinant DNA. C) Difference between southern, northern, and western blotting. Describe what each is looking for?
Which of the following sequences indicates the presence of a rho-independent (intrinsic) transcriptional terminator? A. TGATTTTTTTCGCATTTTAACGAAACGCGCTGCAAAAAAAATTATA...
Which of the following sequences indicates the presence of a rho-independent (intrinsic) transcriptional terminator? A. TGATTTTTTTCGCATTTTAACGAAACGCGCTGCAAAAAAAATTATA B. TGAAAAACGACAAGCAGCGCGAAACGCGCTGCAAAAAAATTATA C. TGAAAAACATCGCATTTTAACGAAACGCGCTGCATTTATTTTTTTT D. TGAAAAACGACAAGCAGCGCGAAACGCGCTGCATTTATTTTTTTT
Which method is more truthful for DNA sequences?
Which method is more truthful for DNA sequences?      
6. RNA ___________________ is post-transcriptional alteration of sequences in mRNAs. 10. RNA splicing involves two __________...
6. RNA ___________________ is post-transcriptional alteration of sequences in mRNAs. 10. RNA splicing involves two __________ reactions? 14. Peptide bond formation in translation occurs by an _______________catalyzed reaction 17. The protein kinase Raf phosphorylates the protein kinase _______, which then phosphorylates (on both threonine and tyrosine residues) ______________________________. 18. Expression of the immediate early genes triggers the expression of a battery of other downstream genes called ________________________________________________.
Why is it important that the initiation of DNA replication is carefully regulated? What is the...
Why is it important that the initiation of DNA replication is carefully regulated? What is the proposed role of DnaA in this process? What extra proteins are necessary for lagging-strand synthesis that are not needed in leading-strand synthesis? Replication in eukaryotes is similar to that of prokaryotes. However initiation is different. Describe how initiation of replication occurs and how it is tied to the cell cycle. Explain in general terms how DNA replication can occur in a chromatin environment and...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT