Question

In: Chemistry

a. Label and give the name for the the major functional groups in the DNA molecule?...

a. Label and give the name for the the major functional groups in the DNA molecule?

b. Functional groups are sites where chemical reactions take place. Using your knowledge of basic organic reactions, think about some possible reactions (e.g. SN2, E1, E2, SN1, etc.) that can occur at each of the functional groups in the DNA molecule?

c. Label the functional groups in the DNA molecule as hydrophobic or hydrophilic? Is the overall DNA molecule generally classified as hydrophobic or hydrophilic? Explain your prediction.

d. Discuss the type of bonding (e.g. ionic, covalent, coordinate covalent, hydrogen bonding, polar covalent, non-polar covalent, etc.) at each functional group within the DNA molecule

e. Label the hybridization (e.g. sp3, sp2, sp, etc.) for the central atom within each functional group in the DNA molecule?

f. Label the bond angle around the central atom in each major functional group within the DNA molecule?

g. Label the geometry of each central atom for each central atom in each functional group in the DNA molecule.

h. Label the major sites in the functional groups in the DNA molecule as acidic, basic or neutral and then label them as nucleophilic, electrophilic sites as well.

Solutions

Expert Solution

(A) DNA or Deoxyribonucleic acid has a helical structure where two strands are attached to each other by combinations of nitrogenous bases. DNA consists of a phosphate group, sugar group and nitrogenous bases. The major functional groups in DNA are:

  • Hydroxyl (-OH)
  • Methyl (-CH3)
  • Carbonyl (-CO)
  • Carboxylic (-COOH)
  • Phosphate (-PO4-2)
  • Amino (-NH2)
  • Sulfadryl (-SH)

(b)   

Fuctional Groups Reaction Type
Hydroxyl Substitution, Elimination
Methyl Substitution
Carbonyl Substitution
Carboxylic Oxidation
Amine Substitution, Elimination

(C)

Fuctional Groups Hydro-philic/phobic
Hydroxyl Polar and hydrophilic
Methyl Non-polar, hydrophobic
Carbonyl Polar, hydrophilic
Carboxylic Polar, acidic and hydrophilic
Amine Polar, basic and hydrophilic
Phosphates

Polar, acidic and hydrophilic

DNA molecule as a whole is hydrophilic. The backbone of the DNA is formed by the sugar moeity and phosphate molecule which are hydrophilic. The nitrogen bases are hydrophobic but are protected by a hydrophilic layer making the whole molecule hydrophilic.


Related Solutions

Identify the major functional groups in the substance below?
Identify the major functional groups in the substance below?  ketal, ketone, acetal hemiacetal, ketone, acetal hemiacetal, ketal, ketone  hemiketal, ketone, ketal  acetal, acetal, ketone
Please name five of the major groups of antineoplastic agents and give a detailed description of...
Please name five of the major groups of antineoplastic agents and give a detailed description of each, including at least one example of a specific medication in each group. Please include both the generic and trade name, along with mechanism of action (what does it do within the body), side effects and interactions.
Assign the functional and molecule groups, with a brief reason why it is: aromatics, alcohols, ethers,...
Assign the functional and molecule groups, with a brief reason why it is: aromatics, alcohols, ethers, ketones, aldehydes, carboxylic acids, esters, amines, amides, amino acids, peptides, proteins, carbohydrates, monosaccharides or polysaccharides, fatty acids or triglycerides, nucleic acids or nucleotides, steroids, eicosanoids, fat soluble vitamins. 1.) Ixerin 2.) Taraxinic Acid 3.) Ainslioside 4.) Cichoric Acid 5.) Mono Caffeoyl Tartaric Acid 6.) 4-Caffoeylquinic Acid 7.) Chlorogenic Acid 8.) Caffeic Acid 9.) Insulin Put multiple functional or molecule groups per number
Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA...
Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA replication: ATCGGCTAGCTACGGCTATTTACGGCATAT TAGCCGATCGATGCCGATAAATGCCGTATA
There are different kinds of isomers, describe them. Name FIVE functional groups and list a property...
There are different kinds of isomers, describe them. Name FIVE functional groups and list a property of each one. Why is carbon so important to life on earth?
What are functional groups? How do the differing charges of functional groups influence the behavior of...
What are functional groups? How do the differing charges of functional groups influence the behavior of the functional groups, the structure of molecules bearing the functional groups, and the interactions of the molecules with water?
Diagram (draw) and describe the process of DNA replication. Include original molecule, the DNA molecule unzipping,...
Diagram (draw) and describe the process of DNA replication. Include original molecule, the DNA molecule unzipping, the addition of new nucleotides, and the products of replication.  
Identify major classes of biomolecules and characteristic functional groups Draw the structure of water molecules including...
Identify major classes of biomolecules and characteristic functional groups Draw the structure of water molecules including atoms, orbital hybridization, bonds, lone pairs, partial charges, and dipole moments
1. Name and draw two biocompatible hydrophilic polymers. Briefly describe their applications. Circle the functional groups...
1. Name and draw two biocompatible hydrophilic polymers. Briefly describe their applications. Circle the functional groups that interact with water. What type(s) of interaction is (are) involved? 2. Draw the following tripeptides in their predominant form at pH 7. Determine the net charge of the predominant form of the peptides at pH 1, pH 7, and pH 12. a. Phe-Thr-Lys b. Trp-Arg-Asp
Name and describe the three major groups of wholesalers. Provide an example of one that you...
Name and describe the three major groups of wholesalers. Provide an example of one that you have shopped at (or are familiar with if you do not have a personal experience) and explain what attracted you to their company (or what shoppers find appealing about the company).
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT