Describe and give examples of biological interactions between algae, fungi, or mosses that have been instrumental...

Describe and give examples of biological interactions between algae, fungi, or mosses that have been instrumental in the evolution of new species. LONG ANSWER.

Expert Solution

solution

examples

Symbiotic asaoaciation between green algae/cyanobacterium and ascomycetes fungi, formation of lichens
Mutualistic relationship between Botrytis ceneria and Pythium irregulare fungus and mosses
Cladonia lichens mycelium grows on protonema of bryophytes

The symbiotic relationship between alga and fungus for mutual benifits living together.

Algae provides photosynthetic nutrition for fungus and fungus provide support to growing alga.

Botrytis Fungus lives in microphylls of bryophyte to provide nutrients to fungus by mosses both are living in biological interaction.

Mycelium of Lichen cladonia grows on peotonema of bryophytes as for absorption of food from mosses.

This is results into evolution of new organism and new species of new characters in biodiversity.

gladiator answered 2 years ago

Name and describe 3 types of community interactions and give examples.

Give an account of the biological mechanisms and molecules used by biotrophic fungi to survive plant...

Give an account of the biological mechanisms and molecules used by biotrophic fungi to survive plant defence responses, after their initial colonisation of plants.

Ecology of human infectious diseases focuses on the interactions between pathogens (e.g. viruses, bacteria, fungi) or...

Ecology of human infectious diseases focuses on the interactions between pathogens (e.g. viruses, bacteria, fungi) or parasites (e.g. protozoa, helminthes) and their human hosts. Using the one disease you are familiar or the disease you worked in your term project as an example, to discuss the need and importance to understand the interactions among various changing ecological factors, pathogens/parasites and human hosts.

describe two (2) experimental techniques that can be used to study the interactions of biological molecules...

describe two (2) experimental techniques that can be used to study the interactions of biological molecules such as peptides with lipids and/or membranes at the cell surface

Describe the interactions between business and government in Canada

Briefly describe the difference between temporary and chronic poverty. Give examples

. Describe the difference between the action of a general and local anesthetic. Give examples of...

. Describe the difference between the action of a general and local anesthetic. Give examples of when each type of anesthetic is used.

1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions....

1.Why are non-covalent bonds important in biological systems? List at least three examples of non-covalent interactions. 2. You want to amplify at least the underlined sequence, you can have some flanking sequence as well. 5’CTGCTACGTACTGGATGACTGACTGTGATGATCTGATCCCAGTGCTCGTAGTCGTGCGTTCGTAATATATAGCGATGGCGCGATGCGATGCGCGTAGCGGCTAGGCGTAGGCGGATTCGGCTAGGCGATGGCGATGGCGATGCGATATTCTAGCGCTAGCGATGAGGTGATTATATCGGCGCTAGCTGATCGTAGCTGATCG 3’ Design the most optimal primers according to Tm and length. Write out each primer and show which is the 5’ and 3’ end of each primer. How big will your PCR product be? 3.. What are the differences between covalent bonds and non-covalent...

Give examples of services that have a good match between customer expectations and service delivery. Give...

Give examples of services that have a good match between customer expectations and service delivery. Give examples of services that do not have a good match

Give an account of the web of interactions between plants and biotrophic species of the fungal...

Give an account of the web of interactions between plants and biotrophic species of the fungal genus trichoderma in the rhizosphere that supports natural biocontrol systems. In your answer, outline how species of trichoderma defend plants against plant pathogens.

Question