DNA sequence may be used to identify different species. Assuming that you can use PCR to...

DNA sequence may be used to identify different species. Assuming that you can use PCR to generate products for sequencing, describe in detail an experiment that will allow you to determine which strain of Salmonella has caused the more recent outbreak.

Expert Solution

according to recent studie and nomenclature, the genus Salmonella contains only two species, Salmonella enterica and Salmonella bongori. S. enterica is subdivided into six subspecies designated as follows: enterica (I), salamae (II), arizonae (IIIa), diarizonae (IIIb), houtenae (IV), and indica (VI), while S. bongori is not divided into subspecies. In PCR we can amplify a oligonunleotide/polynucleotide sequence using a primer, that is complementary of that sequence.

1. 1st we can determine different conserved sequences in different Salmonella.

2. Then we can make probes complementary to those conserved sequence and will amplify the no. of these probes by PCR.

3. when all probes are ready the, probes from each strain were tagged with different markers. It can be a molecule which shows radioactivity. or it can be a fluorescent molecule. when a specific probe will bind to a sequence in DND, it will show either florescence or radioactivity. This will prove the presence of that species of bacteria.

4. now bacterial cell ( suppose Salmonella bongori ) which is collected from infected individual, from that DNA is isolated and southern blotting is performed. When the DNA from test sample is exposed to several different probes(specific for different species and subspecies), only probe specific for Salmonella bongori will bind to it. and will show radioactivity. By this method we can test each sample. and can quantify the no. of cases related to each strain during and outbreak

gladiator answered 1 year ago

The use of DNA analysis to identify individuals is known as A. PCR testing B. DNA...

The use of DNA analysis to identify individuals is known as A. PCR testing B. DNA fingerprinting C. cloning D. None of these DNA identification of individuals is possible because A. individuals, other than identical twins, are genetically unique B. a different restriction enzyme is needed to cut each person’s DNA C. a different species of bacteria is needed for the DNA library of each person D. each person’s DNA uses a different set of bases Which of the following...

As a reminder, PCR is the technique used to replicate DNA in the lab. PCR is...

As a reminder, PCR is the technique used to replicate DNA in the lab. PCR is based on the way DNA is replicated in cells. During PCR template DNA plus other ingredients are placed in a test tube and the solution goes through repeated cycles of heating and cooling. The 'ingredients' of a basic PCR reaction are: DNA template, primer, nucleotides, DNA polymerase, and any salts required for polymerase function (buffer). No ligase is required in PCR but it is...

why concentrated DNA cannot be used in PCR

How can DNA extraction, PCR, and gel electrophoresis be used in forensic science? Explain

You are planning to use PCR to amplify several regions of a piece of DNA. The...

You are planning to use PCR to amplify several regions of a piece of DNA. The sequence of your template DNA is provided below along with the sequences of all available primers. Determine where each of the primers bind and answer the following: 5' AGGGCCAAATGAGATGAGTCAAAAGCTGCCGATAACCGGATAG 3' 3' TCCCGGTTTACTCTACTCAGTTTTCGACGGCTATTGGCCTATC 5' Primer 1: 5-TTGGCC 3 P2: 5-GTCAAA-3 p3: 5-AACCGG-3 p4: 5-CCGGTT-3 P1 can bind to the bottom strand? P4 can bind to the molecule at only one location Which primer pair would...

1.Explain how polymerase chain reaction (PCR) can be used to test the identity of a species....

1.Explain how polymerase chain reaction (PCR) can be used to test the identity of a species. 2. Use technical microbiology terms to describe the shapes and arrangements of bacteria

briefly describe how PCR and gel electrophoresis can be used to analyse DNA samples from crime...

briefly describe how PCR and gel electrophoresis can be used to analyse DNA samples from crime scenes.

DNA may be synthesized by primer elongation methods such as PCR, and if radioactive atoms are incorporated into the newly made DNA

DNA may be synthesized by primer elongation methods such as PCR, and if radioactive atoms are incorporated into the newly made DNA, it may be used as a hybridization probe in methods like Southern blotting. To incorporate radiolabeled nucleotides into newly synthesized DNA, researchers may use 32P-labeled dATP, in which one of the P atom is radioactive32P. Which of the 3 phosphate groups (alpha, beta, or gamma) should be labeled, and why?

PCR can generate over 100 _______________ copies of DNA in hours. , _, _, and ___...

PCR can generate over 100 _________________ copies of DNA in hours. ____, _____, _____, and _____ are the nucleotides needed to ______ copies of DNA Why do we need to add primers? What can DNA Polymerase withstand that other enzymes cannot? When do your desired fragments start to appear? On cycle ________________, you have over a billion copies of DNA. What is the purpose of the agarose gel? What makes the DNA move? DNA migrates to the _________________ end of...

You identify two bacterial species growing together in different environments: species A is an organoheterotroph and...

You identify two bacterial species growing together in different environments: species A is an organoheterotroph and species B is a lithoautotroph. Below are three environments (E1-E3) that both bacteria can grow and reproduce in, different only in the one environmental change highlighted, that you use to test the assumptions of the Molecular Clock hypothesis. You create a taxonomic tree comparing rRNA from one environment (no parentheses) with another control environment (parentheses). Assuming the theory is correct, choose one prediction (A...

Question