Digest the following proteins with the proteases listed and comment whether the original sequence can be...

Digest the following proteins with the proteases listed and comment whether the original sequence can be inferred based on the proteolytic patterns a. MARRIEDEARLYANDPAIDDEARLY: Separately with trypsin and chymotrypsin b. WINETHISAD: Separately with elastase and chymotrypsin. c. MYSTERYPI: With both trypsin and elastase together

Expert Solution

Trypsin digests proteins at the carboxyl side of lysine or arginine.

Chymotrypsin digests proteins at the carboxyl end of Methionine, Tyrosine, tryptophan or phenylalanine.

Elastase digests proteins at the carboxyl end of alanine, valine, serine, glycine, leucine or isoleucine.

similary you can sequence for the other two. Keep in mind W stands for Tryptophan and S stands for Serine.

gladiator answered 1 year ago

Trypsin is an enzyme that can digest the hydrophilic portions of membrane proteins, but it is...

Trypsin is an enzyme that can digest the hydrophilic portions of membrane proteins, but it is unable to penetrate the lipid bilayer and enter a cell. Due to these properties, trypsin has been used in conjunction with SDS-PAGE to determine what proteins have an extracellular domain. Describe an experiment using trypsin to determine the sidedness of proteins of the erythrocyte membrane. BE SURE TO INCLUDE ANY RELEVANT CONTROLS

State for each of the eight types of proteins listed below whether you would expect that...

State for each of the eight types of proteins listed below whether you would expect that protein to have one of the four options, and give a short explanation why: - a nuclear localization signal (NLS), - a mitochondrial signal sequence, - an ER signal sequence, or - no signal sequence. Insulin = ? Adenylyl cyclase = ? Caspase-9 = ? Rb protein = ? Cytochrome c reductase subunit = ? Lysosomal proton (H+) pump = ? Lamin-A protein =...

Comment on the suitability of the following pair of primers in amplifying target sequence of chromosomal...

Comment on the suitability of the following pair of primers in amplifying target sequence of chromosomal DNA. (i) Forward primer: 5’ GCCTCCGGAGACCCATTGG 3’ Reverse primer: 5’ TTCTAAGAAACTGTTAAGG 3’ (ii) Forward primer: 5’ TCGAATTGCCAATGAAGGTCCC 3’ Reverse primer: 5’ GGGACCTTCATTGGCAATTCGA 3’

What is the mRNA sequence of the following original DNA sequences? a) TAC b) GAG c)...

What is the mRNA sequence of the following original DNA sequences? a) TAC b) GAG c) CAT d) AAA e) GCC f) TTC g) CCG h) TGT

What is the purpose of the coupling medium. Comment on whether transducer bandwidth can be increased...

What is the purpose of the coupling medium. Comment on whether transducer bandwidth can be increased and if it is possible describe the method used to increase it. Comment on the terminology you would use to describe the ability of a system to detect low-amplitude echoes accurately.

Calculate the following ratios and comment if the ratio is favorable or unfavorable. All amounts listed...

Calculate the following ratios and comment if the ratio is favorable or unfavorable. All amounts listed are correct and don’t worry if some of the ratios look out of sync, they are intentional. a. Company 1 current assets are $500,000 and current liabilities are $325,000. b. Company 2-Cash and cash equivalents are $100,000, net receivables are $250,000 and current liabilities are $300,000 c. Company 3-total liabilities are $750,000 and the balance in the unrestricted Fund Balance is $850,000 d. Company...

2) Proteins imported to which of the following organelles do NOT have their signal sequence cleaved?...

2) Proteins imported to which of the following organelles do NOT have their signal sequence cleaved? A. Peroxisomes B. Mitochondria C. Endoplasmic reticulum D. Proteins targeted to all of these organelles have their signal sequences cleaved

Comment on whether each of the following statements is true or false. (a) The Durbin Watson...

Comment on whether each of the following statements is true or false. (a) The Durbin Watson statistic is useless because it is based on assumptions that are rarely satisfied in time series regressions. (b) a Durbin Watson statistic below 2 shows negative serial correlation because it is a statistic based on the AR(1) coefficient of the error term. (c) Consider a time series process that follows a random walk drift. Is the first difference of that time series stationary? Is...

Please comment on the economic thought of the following statement, and state why. Then provide whether...

Please comment on the economic thought of the following statement, and state why. Then provide whether you agree or disagree with one or both bulleted statements: Critics have charged that, in carrying out an economic analysis, the commercial nuclear power industry does not consider the cost of decommissioning, or “mothballing,” a nuclear power plant and that the analysis is therefore optimistic. As an example, consider the Tennessee Valley Authority’s Bellefont twin nuclear generating facility under construction at Scottsboro, in northern...

Comment with a brief explanation whether the following statements are true or false: 1. The wavelength...

Comment with a brief explanation whether the following statements are true or false: 1. The wavelength of an electron moving with a velocity of 1.1*10^6 m/s is 6.6 nm. 2. In photoelectric effect, whether an electron will be ejected by light is determined not by the intensity of light but by the wavelength. 3. The temperature of a star can be determined using its radiation spectrum. 4. Resistance-temperature-detector is based on resistivity of a metal decreasing with temperature.

Question