Question

Comment on the suitability of the following pair of primers in amplifying target sequence of chromosomal DNA.

(i) Forward primer: 5’ GCCTCCGGAGACCCATTGG 3’ Reverse primer: 5’ TTCTAAGAAACTGTTAAGG 3’

(ii) Forward primer: 5’ TCGAATTGCCAATGAAGGTCCC 3’ Reverse primer: 5’ GGGACCTTCATTGGCAATTCGA 3’

Answer 1

The properties of a good primer includes:
1. GC content between 40 to 60% the base pair ending must be with G or C
2. A melting temperature should be between 65 °C to 75 °C
3. The length of base pairs between 10 to 30 base pairs
4. For effective results, add 3 to 4 base pairs at 5' end at primer for restriction enzyme

i) Forward primer: 5’ GCCTCCGGAGACCCATTGG 3’ Reverse primer: 5’ TTCTAAGAAACTGTTAAGG 3’
In the forward primer it has a high G/C ratio and it at 3' end G G is present so this is an effective primer.
In the reverse primer, it does not contains significant amounts of G/ C ratio so this reverse primers might not work efficiently
(ii) Forward primer: 5’ TCGAATTGCCAATGAAGGTCCC 3’ Reverse primer: 5’ GGGACCTTCATTGGCAATTCGA 3
In the forward primer it has a high G/C ratio and it at 3' end G G is present so this is an effective primer.
In the reverse primer, it contains significant amounts of G/ C ratio so this reverse primers work efficiently