Question

In: Biology

1 (a). Describe one fundamental way in which proteins and DNA resemble one another and one...

1 (a). Describe one fundamental way in which proteins and DNA resemble one another and one fundamental way in which they differ from one another.

(b). Using the genetic code table provided in lecture (or you can see one here: http://tigger.uic.edu/classes/phys/phys461/phys450/ANJUM02/codon_table.jpg) write the sequence of a mRNA molecule that could encode the following amino acid sequence (for amino acids that are specified by more than one codon, just choose one of the codons; label 5’ and 3’ ends in all figures):

methionine-leucine-valine-lysine-serine-tryptophan-threonine.

(c). Write both strands of the DNA molecule from which this mRNA was transcribed.

(d). Delete the second base of the leucine codon in the mRNA and retranslate your mRNA.

Solutions

Expert Solution

Answer a]

Fundamental ways in which DNA & protein resemble one another=

1]DNA & proteins both consists of Carbon,Hydrogen,Oxygen,nitrogen,phosphorus

Fundamental ways in which DNA & protein differ fromone another as:

structure of DNA consists of a phosphate group which gives negative charge to DNA.

it also consists of a nitrogen base i.e. Adenine ,thymine,guanine & cytosine.

consists of a 5 carbon sugar.

the building block is ribonucleotides

Proteins= the building block is amino acids

amino acids are joined with each other by means of peptide bond forms the protein structure.

In DNA genetic information is stored in the form of codons.that translated into proteins.

b] The sequence of a mRNA molecule that could encode the following amino acid sequence

methionine-leucine-valine-lysine-serine-tryptophan-threonine. IS AS FOLLOWS :

5' AUG - CUU- GUU - AAA - UCU- UGG - ACU 3'--------------mRNA

(c). Both strands of the DNA molecule from which this mRNA was transcribed is

5' AUG - CUU- GUU - AAA - UCU- UGG - ACU 3'--------------mRNA

3' TACGAACAATTTAGAACCTGA 5'--------------two strands of DNA

5' ATGCTTGTTAAATCTTGGACT 3'-----------

(d). By Deleting the second base of the leucine codon in the mRNA and retranslate your mRNA.

methionine-leucine-valine-lysine-serine-tryptophan-threonine. IS AS FOLLOWS :

5' AUG - CUU- GUU - AAA - UCU- UGG - ACU 3'--------------original mRNA

when we delete second base of leucine codon then,

5' AUG - CUG -UU A AAU CUU GG A CU 3'

5'Methionine-leu -stop -3'------------protein


Related Solutions

Describe the way in which DNA is replicated with reference to the following: (a) The formation...
Describe the way in which DNA is replicated with reference to the following: (a) The formation of a replication bubble with 2 replication forks in opposite directions,the involvement of Okazaki fragments in replication, the synthesis of leading and lagging strand and the direction in which chain elongation occurs.
What is an example of an ecosystem? Explain one way that an ecosystem can resemble an...
What is an example of an ecosystem? Explain one way that an ecosystem can resemble an economic system. What are some effects of smog? What’s an environmental impact statement? Why are the business ethics of the environment more international in nature than many other subjects?
Which of the following is not a key way in which business organizations compete with one-another?
Which of the following is not a key way in which business organizations compete with one-another?
What DNA products would be generated if one of the proteins including DNA polymerase, DNA ligase,...
What DNA products would be generated if one of the proteins including DNA polymerase, DNA ligase, sliding clamp for DNA polymerase, nuclease that removes DNA primers, DNA helicase, and primase, were missing?
The processes of transcription and DNA replication are fundamental to the metabolism of cells. Describe the...
The processes of transcription and DNA replication are fundamental to the metabolism of cells. Describe the major stages of each of these two processes .Although very different in terms of biochemistry they do have organizational features in common. In your answer draw attention to some of these. Note Detail and comprehensive is explantation is required.
Briefly describe the strategies of DNA binding proteins to ensure their DNA binding specificity. (5 marks)
Briefly describe the strategies of DNA binding proteins to ensure their DNA binding specificity.
Briefly describe the strategies of DNA binding proteins to ensure their DNA binding specificity. (5 marks)
Briefly describe the strategies of DNA binding proteins to ensure their DNA binding specificity.
Describe the process of protein synthesis starting with DNA in the nucleus and ending with proteins...
Describe the process of protein synthesis starting with DNA in the nucleus and ending with proteins released from the ribosomes. Include the role of the DNA, mRNA, tRNA, rRNA and amino acids.
Isolated naked bacterial DNA from which proteins are removed is supercoiled. DNA in bacterial chromosomes is...
Isolated naked bacterial DNA from which proteins are removed is supercoiled. DNA in bacterial chromosomes is also supercoiled. When naked DNA is nicked, supercoiling is abolished. In contrast nickling chromosomal DNA does not abolish supercoiling. Why?
briefly describe the company’s franchise structure which you researched. Suggest one (1) way in which the...
briefly describe the company’s franchise structure which you researched. Suggest one (1) way in which the company could improve its franchise structure to make it more attractive to potential customers.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT