Question

In: Biology

Retrieve the gene sequence of mitochondrial ATPase subunit 6 from Atlantic hagfish (Myxine glutinosa). Draw a...

Retrieve the gene sequence of mitochondrial ATPase subunit 6 from Atlantic hagfish (Myxine glutinosa). Draw a dotplot against the homologous gene from sea lamprey (Petromyzon marinus), and dogfish.

Solutions

Expert Solution

the gene sequence of mitochondrial ATPase subunit 6 from Atlantic hagfish (Myxine glutinosa) is retrieved from the NCBI database. Retieve the nucleotide sequence within 5153-5839 nucleotide position of the complete mitochondrial genome of Myxine glutinosa

atgataatatctctatttaataccttcgaaagtccatattttctcggcttccctttaataatttttatcgcaatcctaattagtctaa ctatatttatccccgataacaacttactaattaaaaaccaatcctcaatactagcttcaacattcttaaagaccataactaaagaaattt tcagtcctatcaaaaagtctggtcattcttgggcacttcttcttataaccacattaatatttatcttcttaaataacatcaccggacttc tcccctacacattcactgtaacctcccaattatccctaaacatagccatg gctattcctctatgactagg gacaattattataggagcta cctctcaaccttcccactccctagcccacttactcccagagggaactccaataaccctagcccctttcctaattgttattgaatcaatta gtattatcattcgccccttagccttaggggtccgactaacagccaacatcacggcgggccatttactcattcacttagtttctctagccc ttattaatcttactaaatccttacctttactttttctgaccttttcagtattcattttactcttaattctagaactagcagtatccttta tccaagcctatgtattcgtgatactcgtcagtctttacctagaagaaaacttaatttaa

The gene sequence of ATPase subunit 6 of sea lamprey (Petromyzon marinus) is (9222-9935 nucleotide position of the complete mitochondrial genome)

atgacacta gatatctttgaccaatttac ctccccaaca atatttgggc ttccactagc ctgattagct atactagcccctagcttaat attagtttca caaacaccaa aatttatcaa atctcgttat cacacactacttacacccat cttaacatct attgccaaac aactctttct tccaataaac caacaagggcataaatgagc cttaatttgt atagcctcta taatatttat cttaataatt aatcttttaggattattacc atatacttat acaccaacta cccaattatc aataaacata ggattagcagtgccactatg actagctact gtcctcattg ggttacaaaa aaaaccaaca gaagccctagcccacttatt accagaaggt accccagcag cactcattcc catattaatt atcattgaaactattagtct ttttatccga cctatcgccc taggagtccg actaaccgct aatttaacagctggtcactt acttatacaa ctagtttcta taacaacctt tgtaataatt cctgtcatttcaatttcaat tattacctca ctacttcttc tattactaac aattctggag ttagctgttgctgtaatcca ggcatatgta tttattctac ttttaactct ttatctgcaa gaaaacgtttatgtcccacc aagctcatgc ataccacatg gtaga

The gene sequence of ATPase subunit 6 of dogfish (Squalus acanthias) is (8100-8783 nucleotide position of the complete mitochondrial genome)

atgaacctaagtttttttgaccaattcctaagcccatcactccttggaattccactaattgccatagcaat tataattcca tgattaattt tcccaacccc gacaaaccgc tgattaaacaatcgacttat gactgtccaa tcttgattta ttaaccgatt tacataccaa ctaatacaacctataaactt tggaggacat aaatgagcca ccattttaac agccttaata ttatttttaatcactattaa tcttcttggt ctacttccat acacttttac acctacaacc caactatcccttaatatagc atttgctatt cccctttgat taacaactgt tttaattgga atacttaacc aacctactgt tgccctcgga caccttctac cagaaggtac tccaacatta ctaattccgattttaattat catcgaaact attagtctat tcatccgacc tctagcattg ggtgtccgattaactgctaa tttaacagcc ggtcatctcc ttatacaact aattgccacc gcagcttttgtcttaattac tattatacct accgtagctt tattaacatc cctaatttta ttcttactaacaattttaga agttgccgta gcaataatcc aagcatacgt atttgttctt ttactaagtc

Dot plot analysis was performed using LAST web service


Related Solutions

Why is the sequence of the gene that codes the ribosomal small subunit so useful for...
Why is the sequence of the gene that codes the ribosomal small subunit so useful for microbial taxonomy? Cells without a functional ribosome cannot survive Ribosomal genes are often laterally transferred All of these reasons are true Cells without a functional ribosome cannot survive, and ribosomal gene sequences are highly conserved Ribosomal gene sequences are highly conserved
The following sequence is a fragment from the normal version of the Social B gene of...
The following sequence is a fragment from the normal version of the Social B gene of Solenopsis daguerrei ants. You may need to use the codon table provided. DNA SocialB: 5’- ATG TCG GTA GCA TGT GTC TGC-3’ A transition mutation in the sequence results in a change in the 3rd amino acid of the polypeptide chain: Alanine is produced. The DNA sequence with the mutation (the one used to name the SNP 5’ to 3’) is_______. Options - a....
Besides adding more data, why would researchers sequence several genres from the nuclear and mitochondrial genomes,...
Besides adding more data, why would researchers sequence several genres from the nuclear and mitochondrial genomes, as opposed to using just one gene to generate their phylogenetic hypothesis?
For the following sequence read that comes from an internal exon within a gene, what is...
For the following sequence read that comes from an internal exon within a gene, what is the amino acid sequence that is encoded? 5’ TTAAGTAGCCGCTAG 3’
Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the...
Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the boxed G/C base pair and proceeds from left to right. 5’-CCGATAAATGGCCGATTACGATATGCCAGATCATTACAACTAACGAGGCC -3’ 1 - - - - - - - - - - +- - - - - - - - - - -+- - - - - - - - - - +- - - - - - - - -+ - - - - - - - - - - - -+...
6) Why is it that only maternal mitochondrial DNA passes on from parent to offspring? (10...
6) Why is it that only maternal mitochondrial DNA passes on from parent to offspring? (10 pts) Assume the following for questions 7 & 8. Show work via Punnett squares a) Handedness is determined via maternal effect. b) Left handedness is recessive. c) Right handedness is dominant. 7) If your grandmother had the homozygous recessive trait and your grandfather was homozygous dominant what was your mother’s genotype and phenotype? (10pts) 8) Your father is heterozygous. What is your genotype and...
A student is tasked with cloning a specific gene-coding sequence from a human cancer cell in...
A student is tasked with cloning a specific gene-coding sequence from a human cancer cell in order to produce the corresponding protein in bacteria at a concentration sufficient to conduct in vitro biochemical studies. B) Another student mentions that her should have cloned the gene sequence using mRNA instead of genomic DNA. Is this a good suggestion? How does one go about doing this?
The following is a portion of the non-template DNA sequence from the human ras gene. Answer...
The following is a portion of the non-template DNA sequence from the human ras gene. Answer the following questions about this gene and the effects of gene changes to the specified mutant sequence (mutation in BOLD). Normal human ras: 5’-acatgactgaatataaacttgtggtagttggagctggt-3’ Mutant human ras: 5’-acatgactgaacataaacttgtggtagttggagctggt-3’ a. (4) What is the normal human Ras amino acid sequence from this portion of the gene, starting with the first start codon? b. (2) Which amino acid from the normal sequence is mutated, and what...
1. The given mRNA sequence is transcribed from the gene below it. 5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’ 3’...
1. The given mRNA sequence is transcribed from the gene below it. 5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’ 3’ TGAAGCATATTAGTACCGATGTCGAAGCTTGAGTACGTCCCGGTGGGCTAATGGTACATTCAATGCGT5’ 5’ ACTTCGTATAATCATGGCTACAGCTT CGAACTCATGCAGGGCCACCCGATTACCATGTAAGTTACGCA 3’ Within the double-stranded DNA above: a. Which strand ( top / bottom ) is the coding strand? b. Circle the -10 promoter element. c. Underline a single nucleotide indicating the transcription start site. d. Circle the translation start and stop codons. e. What is the amino acid sequence encoded by the mRNA given? Don’t forget that there is always...
please draw a sequence diagram Basic package: 6 window sensor, 3 door sensor, 1 motion sensor,...
please draw a sequence diagram Basic package: 6 window sensor, 3 door sensor, 1 motion sensor, 1 glass sensor Basic Plus: 10 window sensor, 4 doors sensor, 2 motion sensor, 2 glass sensor Elite: 15- window sensor, 6 doors sensor, 3 glass sensor All packages will also include an alarm system devices of a give package are with the alarm system. Customers have the option to disable a device. Customers can also armed or disarm the system. Customers would need...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT