Question

In: Biology

Explain how the major and minor grooves in DNA are involved in binding of enzymes and...

Explain how the major and minor grooves in DNA are involved in binding of enzymes and other proteins.

Solutions

Expert Solution

The major and minor groove arise due to the orientation of the base pairs across the helix. The grooves separate the two sugar-phosphate backbones from each other and the atoms exposed in the grooves are accessible to the solvent and to interactions with proteins.

The enegetics profiles of a significant number of protein-DNA systems at 20°C reveal that, despite of the comparable Gibbs free energies, association with the major groove is primarily an enthalpy driven process. Certain proteins bind to DNA to alter its structure or to regulate transcription or replication. It is easier for these DNA binding proteins to interact with bases which are the internal part of the DNA molecule on the major groove side as the backbones are not in the way. Whereas binding to the minor groove is characterised by the unfavourable enthalpy that is compensated by favourable entropic contributions.

The alpha - helix is the most frequently used secondary structure element for specific DNA recognition in the major groove. The positioning of the helix in the major groove can vary between different protein families and also among different proteins with the same family .

PLEASE LIKE THE ANSWER AND GIVE A THUMBS UP.


Related Solutions

Explain how DNA is replicated.Be sure to include the enzymes involved in the process.
Explain how DNA is replicated.Be sure to include the enzymes involved in the process.
Make a line drawing of DNA in which you show the major and minor groove. Explain...
Make a line drawing of DNA in which you show the major and minor groove. Explain how base stacking and hydrogen bonding contribute to the double helix.
What role does a nucleosome play in DNA structure? Why is there a major and a minor groove in DNA?
What role does a nucleosome play in DNA structure? Why is there a major and a minor groove in DNA? Describe, in simple terms, the hallmarks of DNA structure.
2. Protein-DNA binding a) List the types of interactions that are involved between a protein that...
2. Protein-DNA binding a) List the types of interactions that are involved between a protein that binds DNA non-specifically and DNA. b) List two proteins that bind to DNA non-specifically. c) List the types of interactions usually involved between a sequence-specific DNA binding protein and DNA. d) List two proteins that bind DNA specifically. e) What is the difference between non-specific and specific protein binding to DNA?
Create a table including the names and functions of the major enzymes and proteins involved in...
Create a table including the names and functions of the major enzymes and proteins involved in DNA replication. 1.Enzyme 2.Helicase 3.Primase 4. Topoisomerase 5. DNA polymerase 1 6. DNA polymerase 2 7. DNA polymerase 3 8. Ligase
Can anyone clearly explain: 1. What is end-stacking binding mode in Triplex DNA binding? 2. How...
Can anyone clearly explain: 1. What is end-stacking binding mode in Triplex DNA binding? 2. How are the effects of the end-stacking when a ligand binds with a triplex DNA? 3. How is binding affinity involved in this case?
Briefly explain how the lagging strand is replicated. Include how the replication starts, the enzymes involved...
Briefly explain how the lagging strand is replicated. Include how the replication starts, the enzymes involved and the completion of the lagging strand replication
List and explain the functions of three different enzymes that participate in DNA replication. How does...
List and explain the functions of three different enzymes that participate in DNA replication. How does DNA polymerase work to proofread a DNA strand?
explain the role of that DNA ligase, restriction enzymes and plasmids have in creating recombination DNA
explain the role of that DNA ligase, restriction enzymes and plasmids have in creating recombination DNA
Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA...
Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA replication: ATCGGCTAGCTACGGCTATTTACGGCATAT TAGCCGATCGATGCCGATAAATGCCGTATA
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT