Question

1. Which of components of the electron transport chain directly move protons across the inner mitochondrial membrane?

2. Consider fermentation.
How much ATP is generated during fermentation?

How does the amount of ATP generated by fermentation compare to aerobic respiration?


In humans, why can't fermentation sustain life? (Hint: Think of two reasons—one is related to the product of fermentation and what happens if it accumulates.)

3. Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA replication:

ATCGGCTAGCTACGGCTATTTACGGCATAT

TAGCCGATCGATGCCGATAAATGCCGTATA

Answer 1

1) electron transport chain is composed of 5 complex

Complex I , NADH cow dehydrogenase

Complex II, succinate dehydrogenase

Complex III, cytochrome reductase

Complex IV, cytochrome oxidase

Complex V, ATP synthase

Out of 5 complex complex I,III and IV are the components where enough amount of energy released which is used to transport proton across the membrane and generate proton motive force.

2) fermentation is the process where respiration occurs in absence of oxygen. The amount of energy released during fermentation is less only 2 molecules of ATP are produced.

In the process of glycolysis glucose is converted in to pyruvate. In absence of oxygen, this pyruvate is converted in to alcohol with use of NADH and generate again NAD. This NAD is again utilized by glycolysis. This way glycolysis can be continued in absence of oxygen.

But of we talk about aerobic respiration, here pyruvate produced converted in to acetyl coA , enters in to TCA cycle and produces large amount of energy. According to the recent new calculations 1 glucose molecule upon complete aerobic respiration produce 32 molecules of ATP which is way more than fermentation ( produce 2ATP)

Energy production during fermentation is explained below

In humans we can sustain our life using fermentation

- it produce less energy

- it will lead to build up lactic acid in the body which cause shift of body neutral pH to acidic side. This will be harmful to the body.  

Please post questions separately