Question

In: Anatomy and Physiology

Write and describe about the important of Protein and Amino Acids Test in healthcare or industry....

Write and describe about the important of Protein and Amino Acids Test in healthcare or industry.

Note: The report must not exceed 3 pages minimum (NOT include references), type of test, purposes and the important of the test with reliable references

subject biochemestry

Solutions

Expert Solution

Plasma amino acids is a screening test done on infants that looks at the amounts of amino acids in the blood. Amino acids are the building blocks for proteins in the body. See also: Amino acids - urine. Inborn errors of metabolism

Amino acids are the building blocks of proteins

Amino acids are a vital part of diets for both humans and animals. Several of the amino acids (histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine) can not be produced by the human body and are therefore considered “essential”. A lack of any of the essential amino acids in the diet can lead to poor health and death. In addition, what constitutes essential amino acids can vary. For example, cats cannot synthesize taurine and lack of taurine causes eye-problems, hair loss, and tooth decay. For that reason, amino acid testing is important to determine the quality of protein in food, pet food, and animal feeds.

Eurofins is the leader in amino acid analysis offering a variety of methods that can quickly and accurately quantify the amino acids present in almost any sample. Eurofins has established methods in testing for free amino acids as well as the bound molecules in peptide form.

The total protein test is a simple, routine urine or blood test. It looks for normal or abnormal protein levels in the body.

Having too many or too few proteins can lead to unexpected weight loss, fatigue, or inflammatory disease. The total protein test can help diagnose liver and kidney diseases, along with other conditions.

In this article, we discuss the total protein test, how to interpret the results, and what normal or abnormal protein levels might mean.

What is the total protein test?

Share on Pinterest

The total protein test can help a doctor diagnose various conditions.

Proteins serve as building blocks for many organs, hormones, and enzymes. Proteins are essential for overall health, which is why routine health checkups often include a total protein test.

A total protein test measures the total number of proteins present in body fluid. The test examines protein in either urine or the liquid portion of the blood, which medial professionals call the serum.

Blood test

A serum total protein test measures the amount of albumin and globulin present in the serum portion of the blood:

Albumin protein accounts for half of the total protein found in blood plasma. It regulates oncotic pressure in the plasma to prevent water from leaking out of the blood vessels.

Globulin proteins vary in size, weight, and function. They are grouped by how they migrate on electrophoresis and include α1, α2, β and γ fractions. They include carrier proteins, enzymes, complement, and immunoglobulins (also called antibodies).

Urine test

A urine total protein test detects the amounts of protein present in the urine.

The kidneys filter albumin and other proteins from the blood so that the urine may contain small amounts of protein.

However, problems with the urinary tract, such as chronic kidney disease, can cause large amounts of protein to leak into the urine.

Normal protein levels in urine and blood

Laboratories may use slightly different total protein ranges, depending on the testing method and equipment they use.

The normal range for protein levels in blood serum is 6 to 8 grams per deciliter (g/dl). Of this, albumin makes up 3.5 to 5.0 g/dl, and the rest is total globulins. These ranges may vary between different laboratories.

Usually, a person’s body eliminates less than 150 milligrams (mg) of total protein and less than 20 mg of albumin through the urine every 24 hours.

High or low serum or urine protein levels do not always signal a chronic medical condition. Everyday factors that can affect a person’s protein levels include:

intense exercise

diet

stress

age

degree of hydration during the test

pregnancy

taking hormonal birth control pills

complications from surgery


Related Solutions

Write and describe about the important of Protein and Amino Acids Test in healthcare or industry....
Write and describe about the important of Protein and Amino Acids Test in healthcare or industry. Note: The report must not exceed 3 pages maximum (NOT include cover page and references), type of test, purposes and the important of the test with reliable references Write and describe about the important of Protein and Amino Acids Test in healthcare or industry. Note: The report must not exceed 3 pages maximum (NOT include cover page and references), type of test, purposes and...
A gene is composed of DNA and a protein is composed amino acids. Describe the steps...
A gene is composed of DNA and a protein is composed amino acids. Describe the steps involved in converting the information contained in a gene into a protein. **Please include and define all of the following terms in your description:** Ribosome, template strand, non-template strand, reading frame, complementary, tRNA, mRNA, start codon, stop codon, transcription factors, 5’ to 3’, translation, transcription, gene promoter, RNA polymerase
A large protein of 1205 amino acids was produced errors of average 8 mistakes/200 amino acids....
A large protein of 1205 amino acids was produced errors of average 8 mistakes/200 amino acids. Calculate probability to produce protein with: No mutation Less than 2 mutations Exactly 3 mutations Give mathematical expression and the number used in these expressions.
Explain why all protein sources are not the same. (Hint: think about limiting amino acids and...
Explain why all protein sources are not the same. (Hint: think about limiting amino acids and complementary proteins)
protein molecules are polypetide chains are made up of amino acids in their phisologically functoning or...
protein molecules are polypetide chains are made up of amino acids in their phisologically functoning or native state these chains fold in a unique manner such that the nonpolar groups of the amino acids are usually burired in the interior region of the proteins where there is little or no contact with water. when a protein denatures the chain unfolds so that these non polar groups are exposed to water. a useful estimate of the changes of the thermodynamic quantities...
protein molecules are polypetide chains are made up of amino acids in their phisologically functoning or...
protein molecules are polypetide chains are made up of amino acids in their phisologically functoning or native state these chains fold in a unique manner such that the nonpolar groups of the amino acids are usually burired in the interior region of the proteins where there is little or no contact with water. when a protein denatures the chain unfolds so that these non polar groups are exposed to water. a useful estimate of the changes of the thermodynamic quantities...
5. How could you take a protein with a known sequence of amino acids and use...
5. How could you take a protein with a known sequence of amino acids and use it to make an artificial gene?
3. Describe the two major routes by which the amino groups are removed from amino acids:...
3. Describe the two major routes by which the amino groups are removed from amino acids: transamination, oxidative deamination. Describe the role played by pyridoxal phosphate, glutamate, α–ketoglutarate, and glutamate dehydrogenase in these processes.
suggest how a protein might have been hydrolyzed to give the amino acids. keep in mind...
suggest how a protein might have been hydrolyzed to give the amino acids. keep in mind that this is made from human consumption.
1) How many amino acids long is the protein with the following sequence? 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’...
1) How many amino acids long is the protein with the following sequence? 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’ agattttacagtctacatttcacgtgtagtcatcagaatgagagtcaaaacattgttgag 5’ 2) Design a set of 6 base pair long primers that scientists could use to amplify the entire sequence of the gene in Q1 3) T/F. A base pair substitution (ie. a point mutation) that introduces a nonsense mutation could be introduced to the sequence encoding the protein in Q1.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT