Write and describe about the important of Protein and Amino Acids Test in healthcare or industry....

Write and describe about the important of Protein and Amino Acids Test in healthcare or industry.

Note: The report must not exceed 3 pages maximum (NOT include cover page and references), type of test, purposes and the important of the test with reliable references

Write and describe about the important of Protein and Amino Acids Test in healthcare or industry.

Note: The report must not exceed 3 pages maximum (NOT include cover page and references), type of test, purposes and the important of the test with reliable references

Write and describe about the important of Protein and Amino Acids Test in healthcare or industry.

Note: The report must not exceed 3 pages minimum , type of test, purposes and the important of the test with reliable references

biochemistry I need an expert

Expert Solution

Answer- Proteins as we know are the building blocks of the body, they help in many functions like maintainance providing nutrients for the overall rowth of the human body and cells, transporting molecules throughout the body, it also helps in protection of the body from viruses and other harmful external pathogens. They also associate with other proteins to perform different essential functions of the body.

Proteins are made up of amino acids. Amino acids are compounds that have one amine group and one hydroxyl group, contains major elements like H, O, N and C. 2 amino acids are linked together by peptide bonding and when more than two amino acids join together they are called proteins. Proteins exhibit their function when they are in their quaternary state.

For the healthcare industry, proteins and amino acids are very essential elements. The process of conversion of DNA to proteins is called transcription and it is an essential requirement for our body to perform various functions. The transcription of many proteins leads to the resulting body functions like transporting various substances across various membranes, working in the ion channels, recieving signal molecules, etc. Biotechnologists these days are engineering the proteins upto a specific structure through bioinformatic techniques and bringing it into laboratories, to make it specific according to our needs of treating some disease or inhibiting some function that could be benefitial to help the body fight against infection.

These proteins are called recombinant proteins that are made by incorporating ot deleting some genes from the genome resulting in a particular asset or function. Proteins are also helpful in treating a disease against some infection or pathogen.

Hope the answer is satisfying, kindly leave a rating!

gladiator answered 1 year ago

Write and describe about the important of Protein and Amino Acids Test in healthcare or industry....

Write and describe about the important of Protein and Amino Acids Test in healthcare or industry. Note: The report must not exceed 3 pages minimum (NOT include references), type of test, purposes and the important of the test with reliable references subject biochemestry

A gene is composed of DNA and a protein is composed amino acids. Describe the steps...

A gene is composed of DNA and a protein is composed amino acids. Describe the steps involved in converting the information contained in a gene into a protein. **Please include and define all of the following terms in your description:** Ribosome, template strand, non-template strand, reading frame, complementary, tRNA, mRNA, start codon, stop codon, transcription factors, 5’ to 3’, translation, transcription, gene promoter, RNA polymerase

A large protein of 1205 amino acids was produced errors of average 8 mistakes/200 amino acids....

A large protein of 1205 amino acids was produced errors of average 8 mistakes/200 amino acids. Calculate probability to produce protein with: No mutation Less than 2 mutations Exactly 3 mutations Give mathematical expression and the number used in these expressions.

Explain why all protein sources are not the same. (Hint: think about limiting amino acids and...

Explain why all protein sources are not the same. (Hint: think about limiting amino acids and complementary proteins)

protein molecules are polypetide chains are made up of amino acids in their phisologically functoning or...

protein molecules are polypetide chains are made up of amino acids in their phisologically functoning or native state these chains fold in a unique manner such that the nonpolar groups of the amino acids are usually burired in the interior region of the proteins where there is little or no contact with water. when a protein denatures the chain unfolds so that these non polar groups are exposed to water. a useful estimate of the changes of the thermodynamic quantities...

protein molecules are polypetide chains are made up of amino acids in their phisologically functoning or...

protein molecules are polypetide chains are made up of amino acids in their phisologically functoning or native state these chains fold in a unique manner such that the nonpolar groups of the amino acids are usually burired in the interior region of the proteins where there is little or no contact with water. when a protein denatures the chain unfolds so that these non polar groups are exposed to water. a useful estimate of the changes of the thermodynamic quantities...

5. How could you take a protein with a known sequence of amino acids and use...

5. How could you take a protein with a known sequence of amino acids and use it to make an artificial gene?

3. Describe the two major routes by which the amino groups are removed from amino acids:...

3. Describe the two major routes by which the amino groups are removed from amino acids: transamination, oxidative deamination. Describe the role played by pyridoxal phosphate, glutamate, α–ketoglutarate, and glutamate dehydrogenase in these processes.

suggest how a protein might have been hydrolyzed to give the amino acids. keep in mind...

suggest how a protein might have been hydrolyzed to give the amino acids. keep in mind that this is made from human consumption.

1) How many amino acids long is the protein with the following sequence? 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’...

1) How many amino acids long is the protein with the following sequence? 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’ agattttacagtctacatttcacgtgtagtcatcagaatgagagtcaaaacattgttgag 5’ 2) Design a set of 6 base pair long primers that scientists could use to amplify the entire sequence of the gene in Q1 3) T/F. A base pair substitution (ie. a point mutation) that introduces a nonsense mutation could be introduced to the sequence encoding the protein in Q1.

Question

Write and describe about the important of Protein and Amino Acids Test in healthcare or industry....

Solutions

Expert Solution

Related Solutions

Write and describe about the important of Protein and Amino Acids Test in healthcare or industry....

A gene is composed of DNA and a protein is composed amino acids. Describe the steps...

A large protein of 1205 amino acids was produced errors of average 8 mistakes/200 amino acids....

Explain why all protein sources are not the same. (Hint: think about limiting amino acids and...

protein molecules are polypetide chains are made up of amino acids in their phisologically functoning or...

protein molecules are polypetide chains are made up of amino acids in their phisologically functoning or...

5. How could you take a protein with a known sequence of amino acids and use...

3. Describe the two major routes by which the amino groups are removed from amino acids:...

suggest how a protein might have been hydrolyzed to give the amino acids. keep in mind...

1) How many amino acids long is the protein with the following sequence? 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’...