The PH is within the normal range and CO2 and HCO3- are moving in the same...

The PH is within the normal range and CO2 and HCO3- are moving in the same direction, how would you classify this blood gas?

Solutions

Expert Solution

Normal PH value -7.35 -7.45
Normal Paco2    35-45 mmhg
Normal Hco3 22-26meq/l
   If paco2 is within normal range we must conform the basic acid-base disturbance whether paco2 is abnormal or Hco3 metabolic is abnormal and change in the same direction as PH
   PH should be evaluated first to see the acid-base status..then paco2 and Hco3 can be evaluated..if all these parameters are in normal range then that is normal acid -base status..
When there are two primary acid-base problems both moving PH in same direction is called 'Mixed' or 'combined'
Mixed acid based disturbances accur when there is combination of primary acid-based disturbances it was fully compensated...because the body has corrected the problem..
PH -within normal range
Paco2 less than 35 -Alkalotic
Hco3 less than 22- Acidic
This values representing compensation(either fully or partially)
Paco2 and Hco3 is in a same range means there will be some few points variation..so it is respiratory alkalosis,fully compensated by the means of Metabolic acidosis..

Nightingale answered 1 year ago

Next > < Previous

Related Solutions

A patient has the following acid base values: pH: 7.49 CO2: 31 HCO3: 25 The nurse...

A patient has the following acid base values: pH: 7.49 CO2: 31 HCO3: 25 The nurse interprets these values as: Group of answer choices Respiratory acidosis. Respiratory alkalosis. Metabolic acidosis. Metabolic alkalosis. Flag this Question Question 2 A patient has the following acid base values: pH: 7.31 CO2: 41 HCO3: 19 The nurse interprets these values as: Group of answer choices Respiratory acidosis. Respiratory alkalosis. Metabolic acidosis. Metabolic alkalosis. Flag this Question Question 3 A patient has the following acid...

A drinking water sample has pH of 7.9, 173 of mg/HCO3- L, 3mg/L of CO2(aq) and...

A drinking water sample has pH of 7.9, 173 of mg/HCO3- L, 3mg/L of CO2(aq) and negligible CO32- . Calculate the alkalinity of the water in unit of mg/L as CaCO3

Which of the following are ways CO2 is transported in the blood? A. As bicarbonate (HCO3–)...

Which of the following are ways CO2 is transported in the blood? A. As bicarbonate (HCO3–) B. As dissolved C02 in plasma C. As carbaminohemoglobin D. All of the above E. None of the above

Interpret the following Arterial Blood Gases 1. pH 7.33 PaCO2 60 HCO3 34 A. Normal ABG...

Interpret the following Arterial Blood Gases 1. pH 7.33 PaCO2 60 HCO3 34 A. Normal ABG values B. Respiratory acidosis without compensation C. Respiratory acidosis with partial compensation D. Respiratory acidosis with full compensation 2. pH 7.48 PaCO2 42 HCO3 30 A. Metabolic acidosis without compensation B. Respiratory alkalosis with partial compensation C. Respiratory alkalosis with full compensation D. Metabolic alkalosis without compensation 3. pH 7.38 PaCO2 38 HCO3 24 A. Respiratory alkalosis B. Normal C. Metabolic Alkalosis D. None...

Cellular Dysfunction 1. Decreased pH in cytosol below the normal range 2. Decreased pH in mitochondria...

Cellular Dysfunction 1. Decreased pH in cytosol below the normal range 2. Decreased pH in mitochondria below the normal range 3. Increase in ATP 4. Increase in Hydrolysis 5. Decreasing levels of Glycogen and Triglycerides 6. Inherited Autosomal Recessive Mutation of hydrolytic enzymes (inherited at the organismal level, but impacts the single cell found in a tissue) ? Normal portion of gene: ATGCCCGCCCGCCGTTAGGCATCGCA ? Mutated portion of gene: ATGCCGCGCCCGCCGTTAGGCATGCGCA 7. Increased activity of mitogen-activated protein kinase(s) 8. Poor Ion transport...

Explain how the cell reproduction rate and differentiation are kept within the normal range to avoid...

Explain how the cell reproduction rate and differentiation are kept within the normal range to avoid the formation of neoplasms. (in regards to leukemia cancer)

1. Carbonic anhydrase catalyzes the reverse reaction (of course!): HCO3 - + H+  CO2 +...

1. Carbonic anhydrase catalyzes the reverse reaction (of course!): HCO3 - + H+  CO2 + H2O Initial velocities were measured at the following concentrations of HCO3 - (The enzyme concentration was 0.0025 mg/ml; the enzyme Mr = 29,100 Da.): [HCO3 -] mM 1.3 2.6 6.5 13.0 26.0 vo (µM/sec) 2.5 4.00 6.30 7.60 9.00 vo (µM/sec) with acetazolamide 1.17 2.10 4.00 5.70 7.20 a. Do the required calculations and graph the results as a Lineweaver-Burk plot. Use the X-...

how is toxicity related in plasma binging How do the levels of co2 and hco3 in...

how is toxicity related in plasma binging How do the levels of co2 and hco3 in blood differ in Respiratory acidosis (RA) and (Metabolic Acids)

Within what pH range can Cu2+ be separated from Fe2+ if their concentration is both 0.1M...

Within what pH range can Cu2+ be separated from Fe2+ if their concentration is both 0.1M and H2S concentration is 0.01M? Show all calculations to support your answer. (KCuS = 1.2x10^-36; KFeS = 4.9x10^-18; KH2S = 1.3x10^-20)

Compare the concentration of HCO3- in a normal person and in our patient. Then calculate the...

Compare the concentration of HCO3- in a normal person and in our patient. Then calculate the concentration of H2CO3 in the patient’s blood 10 hours after aspirin ingestion. Again, compare this value to the concentration of H2CO3 found normally, and again address the question of buffer effectiveness in the patient.

Subjects