Question

In: Biology

Explain how a single point mutation in the DNA sequence can have a damaging effect on...

Explain how a single point mutation in the DNA sequence can have a damaging effect on the final protein. Provide a detailed explanation and include reasoning in regard to the transcription and translation processes.

Solutions

Expert Solution

Poiint mutation is a genetic mutation where a single nucleotide base is changed, inserted or deleted from a sequence of DNA or RNA.

Single point mutation in DNA sequence can have damaging effect on the final protein.

For example, sickle-cell disease is caused by a single point mutation (a missense mutation) in the beta-hemoglobin gene that converts a GAG codon into GUG.

​​​​​​It encodes the hydrophobic amino acid valine rather than hydrophilic amino acid glutamic acid at sixth position.

Under low-oxygen conditions (being at high altitude, for example), the absence of a polar amino acid at position six of the β-globin chain promotes the non-covalent polymerisation (aggregation) of hemoglobin, which distorts red blood cells into a sickle shape and decreases their elasticity.

Sickle-Cell Anemia is an autosomal recessive disorder in which sickle-shaped cells cannot carry nearly as much oxygen as normal red blood cells and they get caught more easily in the capillaries, cutting off blood supply to vital organs.

The protein may also exhibit a "gain of function" or become activated, such is the case with the mutation changing a valine to glutamic acid in the BRAF gene. This leads to an activation of the RAF protein which causes unlimited proliferative signalling in cancer cells.

Ps- An upvote would be highly appreciated

Thanks


Related Solutions

Describe how a point mutation in genomic DNA may be detected by MLPA in a single...
Describe how a point mutation in genomic DNA may be detected by MLPA in a single tube. Highlight the critical elements of probes and primers used to detect a “wild type” and single nucleotide variant. Ensure the role of enzyme(s) required for this assay are explained.
How does a point mutation in the DNA have the possibility of resulting in no phenotypic...
How does a point mutation in the DNA have the possibility of resulting in no phenotypic change in an organism. Explain.
In the discussion for fatigue up to this point we have talked about the damaging effect...
In the discussion for fatigue up to this point we have talked about the damaging effect of the number of cycles of loading but we have not discussed about frequency (i.e. how often these loading cycles occur). Which class of materials do you think might be sensitive to the frequency of loading? Provide two physical mechanisms that may affect fatigue life (at least indirectly).
a) Which DNA mutation is more likely to have a detrimental effect on the protein it...
a) Which DNA mutation is more likely to have a detrimental effect on the protein it codes for: a 2 base pair deletion from the middle of the coding sequence of a gene, or a 12-base pair deletion from the same region of the gene? Explain why? b) Would the outcome be different if the deletions happened within the gene’s intron? Explain why?
Mutations can occur in mRNA as well as DNA. Explain why a mutation in mRNA is...
Mutations can occur in mRNA as well as DNA. Explain why a mutation in mRNA is not likely to have serious consequences.
What is the effect of point mutations in DNA on proteins? How does this relate to...
What is the effect of point mutations in DNA on proteins? How does this relate to phenotypic variation, genotypes and alleles? Answer in 4-5 sentences giving a REAL example of such a mutation.  
13. A) A change to a single base pair in the sequence of a DNA molecule...
13. A) A change to a single base pair in the sequence of a DNA molecule is called a ______ mutation. B) If that single nucleotide change results in a protein with the exact same amino acid sequence it is called a _________ mutation. C) If the base pair change results in an alteration of the amino acid sequence of the protein it is called a ___________ mutation. D) If the base pair changes results in a codon for an...
Understand how proteins that regulate the cell cycle can be altered (due to DNA mutation) and...
Understand how proteins that regulate the cell cycle can be altered (due to DNA mutation) and may lead to cancer (uncontrolled cell division). Know the role of tumor-suppressor genes and proto-oncogenes (genes are DNA segments).
What type of mutation would occur from a single nucleotide deletion (point mutation) within the coding...
What type of mutation would occur from a single nucleotide deletion (point mutation) within the coding sequence of a protein-coding gene? a. a frameshift mutation b. a silent point mutation c. a nonsense point mutation d. a missense point mutation e. All of the choices are possible.
Using the following DNA sequence, come up with your own corresponding sequence after a 1) point...
Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation. Also write out the corresponding RNA sequence: AGTAAACGTACCTGAGACGGG Explain how gene regulation in eukaryotes differs from gene regulation in prokaryotes.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT