You have a sample of ssDNA molecule that you will use as a primer for PCR....

You have a sample of ssDNA molecule that you will use as a primer for PCR. You dissolved the dried ssDNA peller in TE to a total volume of 400 ul to make a "stock DNA sample." You need to determine the concentration (ug/ul) of this primer DNA in solution. To do this you took 4 ul from the "stock DNA sample" and added these to 996 ul of TE buffer in a cuvette, making a total of 1000 ul in a cuvette. Next, you determined the absorbance of 260 nm light for this 1 ml of diluted DNA in the cuvette and the A260 value is 0.014.

1) what is the concentration (ug/ul) of the DNA solution in the cuvette?

2) what is the concentration (ug/ul) of the primer DNA in the original Stock DNA sample?

3) what is the total amount (ug) of DNA in the stock DNA sample tube?

4) how many ul of the original "stock DNA sample" would you need to use in a PCR experiment that required a total of 0.25 ug of DNA from this sample?

Expert Solution

Considering 1 OD = 1 g/L

1. Concentration of the DNA solution in the cuvette = 0.014 g/L

2. Dilution = 4/1000 = 0.004

Therefore, Concentration of the primer DNA in the original Stock DNA sample = 0.014/0.004 = 3.5 g/L

3. Volume in the stock tube = 400 L

So, total amount (g) of DNA in the stock DNA sample tube = 3.5 g/L x 400 L = 1400 g

4. Amount of original stock required for a total of 0.25 g of DNA from this sample = 1/3.5 x 0.25 = 0.0714 L

gladiator answered 1 year ago

What is a primer and how does it enable PCR?

Why does DNA sequencing reaction use one primer and PCR use two primers?

why is the forward primer in PCR when adding a sticky end not complementary to the...

why is the forward primer in PCR when adding a sticky end not complementary to the DNA but the reverse primer is?

what would the gel electrophoresis look like if the reverse primer wasn't added to the PCR...

what would the gel electrophoresis look like if the reverse primer wasn't added to the PCR mix? I know that you won't get as much product but I am having trouble visualizing what this would look like on a gel.

how is the sequence specific primer (SSP) PCR and multiplexing method used to analyze HLA type...

how is the sequence specific primer (SSP) PCR and multiplexing method used to analyze HLA type carried out, what are the steps?

If you have a GC reach template, what PCR additives you may use? What is their...

If you have a GC reach template, what PCR additives you may use? What is their function? Can manipulating the thermal cycling condition help? How?

DNA may be synthesized by primer elongation methods such as PCR, and if radioactive atoms are incorporated into the newly made DNA

DNA may be synthesized by primer elongation methods such as PCR, and if radioactive atoms are incorporated into the newly made DNA, it may be used as a hybridization probe in methods like Southern blotting. To incorporate radiolabeled nucleotides into newly synthesized DNA, researchers may use 32P-labeled dATP, in which one of the P atom is radioactive32P. Which of the 3 phosphate groups (alpha, beta, or gamma) should be labeled, and why?

You are planning to use PCR to amplify several regions of a piece of DNA. The...

You are planning to use PCR to amplify several regions of a piece of DNA. The sequence of your template DNA is provided below along with the sequences of all available primers. Determine where each of the primers bind and answer the following: 5' AGGGCCAAATGAGATGAGTCAAAAGCTGCCGATAACCGGATAG 3' 3' TCCCGGTTTACTCTACTCAGTTTTCGACGGCTATTGGCCTATC 5' Primer 1: 5-TTGGCC 3 P2: 5-GTCAAA-3 p3: 5-AACCGG-3 p4: 5-CCGGTT-3 P1 can bind to the bottom strand? P4 can bind to the molecule at only one location Which primer pair would...

Can DNA be amplified from a degraded sample for PCR?

3) How can you use PCR to clone a 2000bp gene into a plasmid vector?

Question