Question

In: Biology

If you have a GC reach template, what PCR additives you may use? What is their...

If you have a GC reach template, what PCR additives you may use? What is their function? Can manipulating the thermal cycling condition help? How?

Solutions

Expert Solution

GC rich pcr amplification required an addictives of chemicals/reagents. We have to check at different temperature yo ensure whether it is worked or not. 2degree centegrades are used normally for different concentration.

Betaine(final concentration from 0.5-2.5m),DMSO(1-5%),ammonium saturated buffer(depends on concentration it will varies) are the most common reagents that are used for GC rich pcr amplification.

Betaine is used to reduce the duplex stability,DMSO and formamide react as a reducing the secondary structure.

TMAC ( tetra methyl ammonium chloride)is used for specificity of hybridization and it also increase the TM.

Yes.manipulation of thermal cycle should maintain certain limits of temperature for certain time.

In thermal cycling initial denaturation starts at 94°C for 30seconds.it is sufficient for all templates.it thermal cycle annealing,elongation-72°c,fill in extension-72°C,Hold-4°C are maintained along with suitable time (seconds).


Related Solutions

You have a sample of ssDNA molecule that you will use as a primer for PCR....
You have a sample of ssDNA molecule that you will use as a primer for PCR. You dissolved the dried ssDNA peller in TE to a total volume of 400 ul to make a "stock DNA sample." You need to determine the concentration (ug/ul) of this primer DNA in solution. To do this you took 4 ul from the "stock DNA sample" and added these to 996 ul of TE buffer in a cuvette, making a total of 1000 ul...
DNA sequence may be used to identify different species. Assuming that you can use PCR to...
DNA sequence may be used to identify different species. Assuming that you can use PCR to generate products for sequencing, describe in detail an experiment that will allow you to determine which strain of Salmonella has caused the more recent outbreak.
What is skewed gc content what what do we use it for?
What is skewed gc content what what do we use it for?
what are real microorganism that may be of positive use or a microorganism that may have...
what are real microorganism that may be of positive use or a microorganism that may have a positive impact on something else (a prokaryote, a eukaryote, an acellular agent) and focus on any aspect of the microorganism – for example structure(s) and/or function(s) – that may have any positive outcome, use, or impact. (1) that it must be within the natural capabilities of the microorganism and must be original.
What additives may be used to prevent acid catalyzed hydrolysis of drugs containing ester moieties in...
What additives may be used to prevent acid catalyzed hydrolysis of drugs containing ester moieties in drug formulations?
What additives may be used to prevent acid catalyzed hydrolysis of drugs containing ester moieties in...
What additives may be used to prevent acid catalyzed hydrolysis of drugs containing ester moieties in drug formulations?
What is an example of when you would use a template? Name at least three benefits...
What is an example of when you would use a template? Name at least three benefits of using a workbook template.
list 3 reasons you would use hplc instead of gc for organic compounds
list 3 reasons you would use hplc instead of gc for organic compounds
You are planning to use PCR to amplify several regions of a piece of DNA. The...
You are planning to use PCR to amplify several regions of a piece of DNA. The sequence of your template DNA is provided below along with the sequences of all available primers. Determine where each of the primers bind and answer the following: 5' AGGGCCAAATGAGATGAGTCAAAAGCTGCCGATAACCGGATAG 3' 3' TCCCGGTTTACTCTACTCAGTTTTCGACGGCTATTGGCCTATC 5' Primer 1: 5-TTGGCC 3 P2: 5-GTCAAA-3 p3: 5-AACCGG-3 p4: 5-CCGGTT-3 P1 can bind to the bottom strand? P4 can bind to the molecule at only one location Which primer pair would...
Outline the differences between RT-PCR and qPCR and what purpose would you use qPCR. (10 marks)
Outline the differences between RT-PCR and qPCR and what purpose would you use qPCR.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT