Question

In: Accounting

If you were the Head of Engineering Faculty, comment on the suitability and the eligibility of...

If you were the Head of Engineering Faculty, comment on the suitability and the eligibility of TzeMay to the position based on her personality traits.

Solutions

Expert Solution

The department

Within the Engineering faculty lies the department of mechanical engineering with some forty staff, most of whom have been at the university for at least eight years and 90 per cent of whom are “career academics‟ who have not held posts in commercial organisations. All are male. The head of department (who is also the Wallace-Price Professor of Engineering) leads the department in a relatively informal and relaxed manner. Like most academics he is a man of ideas rather than an administrator and dislikes formal policies and procedures.

Frequently heard to have made remark that “I do not like tying things or people up in red tape, I prefer a democratic approach”. He has been accused in the past of inconsistency by his staff, of never treating two people in the same way. However, it is true to say that, in general, academic staffs are left to organise their lives as they want within the constraints of their teaching schedule. Their research work is highly respected, several innovative engineering designs have been patented and sold on the open market, and there is a well-established programme of industry collaboration. While the climate of the department is outwardly relaxed and informal, there is very little interaction among staff, particularly outside working hours.

Each academic has his own room, there is no central staff room and many staff work from home, only coming into the department to teach and undertake their administrative duties. Gossip is rife, as is professional jealousy, particularly in terms of gaining research funding. An increase in student numbers, successful franchise arrangements being made to deliver postgraduate courses in China and the Far East and an attempt to reduce teaching loads has led to the department advertising a vacancy for a senior lecturer. Ideally the preferred candidate will have experience of research work, good external business contacts and willing to travel. As is usual in academic institutions, very little, if any, thought is given to the personality of the successful candidate or to the desirability of them fitting in to the rest of the department.

The candidate

TzeMay was one of the first women engineering students at Open University. She graduated in 1995 with a first class honours degree and immediately continued her studies with an MSc programme, gaining recognition for her work into environmentally friendly car engines, a largely untapped field in those days. On completion of her Masters degree she was offered a post as a research assistant where she could have developed her Masters research and worked towards her doctorate. However she decided that she needed to gain some commercial experience and joined Wallace-Price, a blue-chip engineering consultancy where, apart from a sponsored year out to study for an MBA in the United States of America, she has remained ever since.

Her tenacity and loyalty to Wallace-Price have paid off and she was made a partner in the firm, primarily responsible for bringing in work to the consultancy. With the promotion came various executive privileges including an annual salary of £80, 000, a chauffeur-driven car, free use of one of the company-owned London flats, a non-contributory pension scheme, various gold credit cards and first-class air travel. TzeMay herself would not describe these as benefits, however, but as necessities to enable her to do her job properly. In order to meet her business target of £2 million of work for Wallace-Price she spent forty weeks overseas, working an average of ninety hours a week.

She cannot remember the last time that she had a weekend when she was not entertaining clients or travelling but was totally free to indulge herself. During her time with Wallace-Price she has earned a reputation both as a formidable but honest negotiator and as an innovative engineer, often finding seemingly impossible solutions to problems. Known for her single-minded dedication to her job, she does not suffer fools gladly. She is frequently approached to work for rival firms with promises of even greater privileges and has been the subject of numerous magazine profiles, some concentrating on her work and reputation as a high flier but the majority focusing on her gender. Her fortieth birthday last year was spent alone in the Emergency Room of a Los Angeles hospital where she had been rushed with a suspected stomach ulcer. Deprived of her portable telephone, fax and computer she had little else to do but to reflect on her life thus far. On her return to health she was working her way through the pile of technical journals, which had accumulated during her absence and there she saw the advertisement for ABC University, an institution that had close links with her company and whose Professor of Engineering she knew well. Ignoring the instructions relating to applications she put through a telephone call to the ABC University.


Related Solutions

Comment on the suitability of the following pair of primers in amplifying target sequence of chromosomal...
Comment on the suitability of the following pair of primers in amplifying target sequence of chromosomal DNA. (i) Forward primer: 5’ GCCTCCGGAGACCCATTGG 3’ Reverse primer: 5’ TTCTAAGAAACTGTTAAGG 3’ (ii) Forward primer: 5’ TCGAATTGCCAATGAAGGTCCC 3’ Reverse primer: 5’ GGGACCTTCATTGGCAATTCGA 3’
MASS TRANSFER QUESTION. DO NOT COMMENT CHEMICAL ENGINEERING. IF YOU DONT KNOW IT DONT COMMENT. READ...
MASS TRANSFER QUESTION. DO NOT COMMENT CHEMICAL ENGINEERING. IF YOU DONT KNOW IT DONT COMMENT. READ PROBLEM CAREFULLY, AND DRAW DIAGRAM WITH EVERY STEP AND UNIT CONVERSIONS! DO PART A,B, &C. 1-propanol diffuses across a liquid water film in a distillation tower. The temperature is 25 degrees Celsius. The film is 10mm thick and the mole fractions of propanol on either side are 0.020 and 0.0505. The molar density of the film is 55.0 kmol/m^3, and the diffusivity of 1-propanol...
You are the head of the engineering department in a certain company. your department has been...
You are the head of the engineering department in a certain company. your department has been allocated an annual budget of R2.6 million for this year. it is now towards the endof the financial year and your department has overspent by 25%. your senior manager wants you to justify why this is so. YOur task is to present a report showing all the expense of your department for the year and analyse them in a form of a Pareto analysis...
You are the head of the engineering department in a certain company. your department has been...
You are the head of the engineering department in a certain company. your department has been allocated an annual budget of R2.6 million for this year. it is now towards the endof the financial year and your department has overspent by 25%. your senior manager wants you to justify why this is so. YOur task is to present a report showing all the expense of your department for the year and analyse them in a form of a Pareto analysis...
During an experiment to simple vapour compresion cycles in the HVAC lab at Faculty of Engineering,...
During an experiment to simple vapour compresion cycles in the HVAC lab at Faculty of Engineering, Rabigh , the following data are obtained:- • The temperature enter to the compressor is "saturated vapor condition". • The temperature exit the compressor is 55 0C. • The temperature enter to the expansion device is 18.5 0C. • The evaporator gauge pressure is 3.05 bar. • The condenser gauge pressure is 10.7 bar. • The volume flow rate at the evaporator entrance is...
During construction, field tests were conducted to assess the suitability of the column to withstand a...
During construction, field tests were conducted to assess the suitability of the column to withstand a safe buckling load of 2.5 kN assuming a factor of safety 4 using two different hollow columns made up of steel and concrete. Both columns have same cross section but varying length and different support conditions. Steel column of length 3 m having external diameter 40 mm was tested with one end fixed and the other end hinged, when subjected to a compressive stress...
The course is health communication Assignment title or task: - If you were the head of...
The course is health communication Assignment title or task: - If you were the head of health communication unit at Saudi MOH, how will you improve the health communication strategies used now during COVID-19 - Give suggestions and/or recommendations - Briefly discuss the importance of citizen engagement in health communication please write the answer without hand and 700 words
If you were the head of an HR organization, would you recommend ban of box policy...
If you were the head of an HR organization, would you recommend ban of box policy for your company-- and provide your specific reasons why you would or would not adopt this policy
briefly comment on the application of geotechnical engineering in constructing the gigantic structure on the Arabian...
briefly comment on the application of geotechnical engineering in constructing the gigantic structure on the Arabian gulf
You were asked by the Manager of Engineering to propose a solution for a current production...
You were asked by the Manager of Engineering to propose a solution for a current production line problem. After analyzing the issues you came up with two solutions, both of which will solve the problem for the next five years. Solution A would initially cost $90,000, have annual O&M costs of $22,000 and will generate annual savings of $48,000, while solution B will need an initial $62,000, $17,000 for annual O&M costs, and will generate annual savings of $36,000. Both...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT