The following is a template strand: 5' CGC CGT ATA CGC 3' What is the coding...

The following is a template strand: 5' CGC CGT ATA CGC 3'

What is the coding strand? (3' to 5')

What is the mRNA transcript? (5' to 3')

What is the protein Sequence? from N-term to C-term?

Expert Solution

Template Strand:It is the strand used by RNA polymerase inorder to attach complementary bases during the process of RNA transcription.

Coding Strand is the strand which donot code for the RNA formed,But base pairs in the coding strand will be corresponding to the RNA transcript Produced.

Coding Strand have basepairs complementary to the Template strand

Here,Coding Strand:3' GCG GCA TAT GCG 5'.[Adenine base pair with Guanine ,Thymine basepair with cytosine]

mRNA transcript:5' GCG GCA UAU GCG 3' [in RNA there is Uracil instead of thymine,Also mRNA formed will have same basepairs as that in the coding strand,(Complimentary to the Template strand)But have Uracil in places of Thymine]

Protein Sequence- From N terminus to T terminus.

Alanine-Alanine-Tyrosine-Alanine.

(GCG codes for Alanine,GCA for alanine UAU for Tyrosine )

Also,RNA traslation occur from 5'-3' the starting Amino acid will be N terminus,then the Next amino end of amino acid binds to Carboxyl end of 1st Aminoacid]

gladiator answered 1 year ago

1. Given the non-template strand of DNA, draw the template strand with the 5' and 3'...

1. Given the non-template strand of DNA, draw the template strand with the 5' and 3' ends labeled. Draw the RNA molecule with the proper 5' and 3' ends labeled Non-Template Strand: 3'- AAT GCT CGT AGC TTC GAT CGG ATC GA-5' 2. How many amino acids would the RNA molecule code for?

Given the non-template strand of DNA, draw the template strand with the 5' and 3' ends...

Given the non-template strand of DNA, draw the template strand with the 5' and 3' ends labeled. Draw the RNA molecule with the proper 5' and 3' ends labeled Non-Template Strand: 3'- AAT GCT CGT AGC TTC GAT CGG ATC GA-5' My answers: Template= 5'- TAT CGA GCA TCG AAG CTA GCC TAG CT-3' RNA Molecule= 3'- AUA GCU CGU UGC UUC GAU CGG AUC GA-5' Next it asks, how many amino acids would the RNA molecule code for? -...

Define the following terms (a) leading strand (b) lagging strand (c) template strand (d) coding strand

Consider a three-base sequence within the coding region in the DNA template strand: 5'-...123...-3', in which...

Consider a three-base sequence within the coding region in the DNA template strand: 5'-...123...-3', in which 1, 2, and 3 refer to the relative positions of deoxyribonucleotides within a codon. What would be the effects of a point mutation that would change a purine for a pyrimidine at position 2? 1. (True/False) This mutation will always result in an altered amino acid sequence in the mutant protein compared to the original protein. 2. (True/False) The mutant amino acid, if changed,...

A sequence of a following DNA template strand 5' - GTAACGGGCACGTCC - 3' was transcribed to...

A sequence of a following DNA template strand 5' - GTAACGGGCACGTCC - 3' was transcribed to an mRNA that was then translated to a protein. What would be the first amino acid in the polypeptide? Assume that no start codon is needed

The codon in the DNA coding strand has the following sequence: 5' - TAC -3' Which...

The codon in the DNA coding strand has the following sequence: 5' - TAC -3' Which of the following codons (result of a mutation) represents a non-sense mutation? Select one: a. TAA b. TAT c. TTC d. TCC

Given the DNA strand, 3’ TTG-TAA-CGC-CAT-ATG-GAC-AGC 5’, what is the resulting amino acid sequence of this...

Given the DNA strand, 3’ TTG-TAA-CGC-CAT-ATG-GAC-AGC 5’, what is the resulting amino acid sequence of this polypeptide? . What tRNA anti codon would bind to each mRNA codon in the last part? Draw how this works by drawing the mRNA interacting with the tRNA in the ribosome.

Question 3: Transcription and Translation Below is the beginning of the coding strand of the protein-coding...

Question 3: Transcription and Translation Below is the beginning of the coding strand of the protein-coding region of the Cdc7 gene in yeast. Note that only the coding strand of the DNA is shown. Please be sure to correctly label the ends of any DNA, RNA or protein sequence written below. 5’ATGACAAGCAAAACGAAGAATATCGATGATATACCTCCAGAAATCAAAGAAGAGATGA TACAGCTCTATCATGATCTACCGGGTATAGAAAATGAATATAAACTCATAGACAAGATC GGTGAGGGAACATTTTCGTCAGTGTATAAAGCCAAAGATATCACTGGGAAAATAATAG3’ A. What is the sequence of the first 10 nucleotides of the template strand? B. What is the sequence of the first 10 nucleotides of the...

Answer the following questions using the sequence given below. Non-template DNA 5’ – ATG CGT TCG...

Answer the following questions using the sequence given below. Non-template DNA 5’ – ATG CGT TCG TTA TGG CTG CTT – 3’ 1. Provide sequence of template DNA 2. Provide sequence of mRNA 3. Provide sequence of tRNA anticodon for the 3rd triplet 4. Provide the sequence of the amino acid encoded by the mRNA 5. What is the effect on the amino acid sequence as a result of each of the following mutations? substitution of T for G at...

1) The following DNA strand is a template strand of a prokaryotic gene.Transcription start siteis indicated...

1) The following DNA strand is a template strand of a prokaryotic gene.Transcription start siteis indicated by a bold “G”. a) Underline the promoter region of this gene by a dotted line. b)Underscore the Pribnow box in the promoter region. What is the function of the Pribnow box? c) Deduce the nucleotide sequence of mRNA for this gene. d) Underscore the leader sequence in mRNA and box the initiation codon. How many amino acids does this mRNA code for? What...

Question