Given the DNA strand, 3’ TTG-TAA-CGC-CAT-ATG-GAC-AGC 5’, what is the resulting amino acid sequence of this...

Given the DNA strand, 3’ TTG-TAA-CGC-CAT-ATG-GAC-AGC 5’, what is the resulting

amino acid sequence of this polypeptide?

. What tRNA anti codon would bind to each mRNA codon in the last part? Draw how this works by

drawing the mRNA interacting with the tRNA in the ribosome.

Expert Solution

Ans

If the DNA strand is 3' TTG-TAA-CGC-CAT-ATG-GAC-AGC 5', the resulting mRNA is 5' AAC-AUU-GCG-GUA-UAC-CUG-UCG3' because mRNA is synthesized from template strand and its sequence is complementary to mRNA. The polypeptide synthesized from this mRNA is asn-ile-ala-val-tyr-leu-ser because AAC codes for asparagine, AUU for isoleucine, GCG for alanine, GUA for valine, UAC for tyrosine, CUG for leucine and UCG for serine.

According to wobble hypothesis, the third base of mRNA is wobble base. If the U is present in third position of mRNA codon, it cans pairs with A or G in the first position of tRNA anticodon. So, if the mRNA sequence is 5'AUU3', the tRNA anticodon sequences are either 5'AAU3' or 5'GAU3'. The resulting tRNA anticodon sequences from each mRNA codon is given below-

The drawing of mRNA interaction with tRNA is given below-

gladiator answered 2 years ago

Given the following CODING STRAND of DNA: ATG TTT CAT GGC TGA TAA - What is...

Given the following CODING STRAND of DNA: ATG TTT CAT GGC TGA TAA - What is the complimentary template strand of DNA? - What would be the mRNA CODON sequence? - What is the anti-CODON of tRNA? And which AMINO ACID would the tRNA bring?

Related to translation: Predict the amino acid sequence for the given template strand of DNA. ...

Related to translation: Predict the amino acid sequence for the given template strand of DNA. 3’- T A C G T T C A T A T C C G T A T G T A T A T T – 5’

Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand? Which of...

Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand? Which of the following? 5’-TCAATGGACT-3’ 3’-AGTTACCTGA-5' ’5’-AGTTACCTGA-3’ 3’-TCAGGTAACT-5’ 5’-TCAGGTAACT-3’

A sequence of DNA reads: 5’ TCT GGC AAT CGC TAT 3’ 1.What is the sequence...

A sequence of DNA reads: 5’ TCT GGC AAT CGC TAT 3’ 1.What is the sequence of nucleotides on the complementary strand of DNA? 2.Which strand of DNA serves as the template strand – 5’ to 3’ or 3’ to 5’? 3.List the sequence of codons that result from the transcription of this DNA 4.What is the sequence of amino acids encoded by this DNA (Refer to the chart on the next page)? 5.How would the sequence of amino acids...

The following is a template strand: 5' CGC CGT ATA CGC 3' What is the coding...

The following is a template strand: 5' CGC CGT ATA CGC 3' What is the coding strand? (3' to 5') What is the mRNA transcript? (5' to 3') What is the protein Sequence? from N-term to C-term?

Now you will translate the amino acid sequence for the given tRNA strand. Remember that codons...

Now you will translate the amino acid sequence for the given tRNA strand. Remember that codons are 3 base pairs long. AUG CAC UGU CCU UUC GCU GAC GAG AUC UGG UUG GAA UCG The following are pieces of mRNA. Give the DNA strand from which it was transcribed. mRNA: G A G A U C U G G U U G G A A U C G DNA : Using the following piece of DNA, give the mRNA molecule,...

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA...

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA strand look like? What would the protein look like? Create a point mutation in the DNA and then give the mRNA and protein sequence. Create a frameshift mutation in the DNA and then give the mRNA and protein sequence.

The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the...

The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the sequences below would most likely bind to this sequence to initiate DNA replication through the formation of RNA ? A. 5′—TTAACGTCTAAGT—3′ B. 3′—TTAACGTCTAAGT—5′ C. 3′—UUAACGUCUAAGU—5′ D. 5′—UUAACGUCUAAGU—3′

A sequence of a following DNA template strand 5' - GTAACGGGCACGTCC - 3' was transcribed to...

A sequence of a following DNA template strand 5' - GTAACGGGCACGTCC - 3' was transcribed to an mRNA that was then translated to a protein. What would be the first amino acid in the polypeptide? Assume that no start codon is needed

Propose a 20 amino acid sequence for an amphipathic beta-hairpin strand.

Question