Question

In: Biology

The β (beta) subunit of E. coli DNA polymerase III possesses which of the following enzymatic...

The β (beta) subunit of E. coli DNA polymerase III possesses which of the following enzymatic activities?

1. 3’- 5’ polymerase

2. 3’- 5’ exonuclease

3. 5’ - 3’ exonuclease

4. 5’ - 3’ polymerase

5. the beta subunit is not an enzyme

Expert Solution

The correct option is the 5th one ( beta subunit has no enzymatic activity)

Beta subunit codes for a clamp. This clamps locks the enzymatic parts on DNA strand and increases the processivity (No of nucleotides added at each binding with DNA or template) ,

DNA polymerase III is the main enzyme for DNA synthesis (replication) in prokaryotes.This enzyme has very high processivity. Since, it is the main enzyme involved in DNA replication, it has dual activity

DNA synthesizing activity in 5'-3' direction

DNA exonuclease activity in 3'-5' direction (proof reading)

DNA pol III is a complex holoenzyme. It has following subunits with different functions-

2 subunits of core enzyme- each consisting alpha, epsilon and theta

a sliding clamp- 2 beta subunits

and a clamp loading complex- with subunits like delta, gamma, psi subunits.

option 1 is incorrect- as 3'-5' polymerase is not found in any DNA polymerase. DNA synthesis always takes place in 5' to 3' direction. Hence, this option is wrong

Option 2 i incorrect as epsilon subunit of DNA polymerase III has 3'- 5' exonuclease (proof reading) activity, not the beta subunit. Hence, this option is wrong

Option 3 is incorrect as- No subunit of DNA polymerase III has 5'-3' exonuclease activity. This activity is shown by DNA polymerase I. Hence, this option is wrong

Option 4 is incorrect as alpha subunit of DNA polymerase possess 5'-3' polymerase activity. Beta subunit shows no polymerase activity . Hence, this option is wrong

gladiator answered 1 year ago

1. Why does E. coli need both DNA polymerase III and DNA polymerase I? a. The...

1. Why does E. coli need both DNA polymerase III and DNA polymerase I? a. The DNA replication is bidirectional; one polymerase is used for each direction. b. Each polymerase is specific for only one strand of DNA. DNA polymerase III acts only on the leading strand, and DNA polymerase I acts only on the lagging strand. c. Only DNA polymerase I has proofreading ability. d. DNA polymerase III lacks the 5' → 3' exonuclease activity needed to remove RNA...

What are the functions of the following enzymes in E. coli? DNA polymerase I __________________________________________________ DNA...

What are the functions of the following enzymes in E. coli? DNA polymerase I __________________________________________________ DNA polymerase II __________________________________________________ DNA polymerase III _________________________________________________ DNA polymerase IV _________________________________________________ DNA polymerase V _________________________________________________ Please indicate (if possible) which is the evolutionary history of these polymerases? Which of them you could be eliminate and preserve the function of the organism? (you must eliminate 2) What will be the consequences? Which environment might be suitable for the survival of this “mutant” that you created?

Which of the following statements correctly contrasts DNA pol III with a translesion DNA polymerase, such...

Which of the following statements correctly contrasts DNA pol III with a translesion DNA polymerase, such as DNA pol IV or V? explain the answer please for each statement. 1. Translesion DNA polymerase has low fidelity, while DNA pol III has high fidelity. 2. DNA pol III is highly processive, but translesion polymerases are not. 3. DNA pol III requires a template strand of DNA, unlike translesion polymerases. 4. DNA pol III polymerizes DNA in a 5' to 3' direction,...

You do a series of incubations to compare the properties of E. coli DNA polymerase I...

You do a series of incubations to compare the properties of E. coli DNA polymerase I and III. After incubating DNA template prepared from bacteriophage T7 with one or the other polymerase for 20 min, you add an excess of a second template, phage T3 DNA and continue the reaction for a further 40 min. You compare the amounts of T3 synthesized to the amount of T7. Most of the DNA synthesized in the polymerase I incubations is found to...

Which of the following is not a property of DNA polymerase?Which of the following is a...

Which of the following is not a property of DNA polymerase?Which of the following is a property of DNA polymerase?It requires a primer to work.Its exonuclease activity is involved in proofreading.It adds dNTPs only in the 3' to 5' direction.It is associated with a sliding clamp both on the leading and lagging strands.

1. E. coli DNA polymerase V has the ability to bypass thymine dimers. However, Pol V...

1. E. coli DNA polymerase V has the ability to bypass thymine dimers. However, Pol V tends to incorporate G rather than A opposite the dam-aged T bases. Would you expect Pol V to be more or less processive than Pol III? Explain. 2. Explain why base excision repair, nucleotide excision repair, and mismatch repair—which all require nucleases to excise damaged DNA—require DNA ligase. 3. Why are there no Pol I mutants that completely lack 5′ → 3′ exo-nuclease activity?

What would happen if we use Polymerase I instead of Polymerase III for DNA replication in...

What would happen if we use Polymerase I instead of Polymerase III for DNA replication in a PCR? If we used an enzyme with low fidelity, how would the DNA product compare to the original template?

Assuming DNA polymerization by each polymerase in the DNA Pol III holoenzyme proceeds at a rate...

Assuming DNA polymerization by each polymerase in the DNA Pol III holoenzyme proceeds at a rate of 1000 nucleotides per second, how long would anormal E.coli cell take to replicate the entire E .coli chromosome? Under optimal condition, E.coli cells divide every 20minutes. How many replication forks will be present in each E.coli to sustain such a rate of division?

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The...

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The strand is transcribed from left to right and codes for a small peptide. a) Is this the mRNA-like coding strand or template strand? b) Which end is the 3' end and which is the 5' end? c) What is the DNA coding strand sequence of the ORF ? d) What is the sequence of the entire transcript (assume the +1 of transcription begins at...

DNA polymerase III builds new DNA strands in the 5' to 3' direction...always adding the new...

DNA polymerase III builds new DNA strands in the 5' to 3' direction...always adding the new nucleotide to the 3' end of the existing strand. As it adds new nucleotides, it proofreads its work. If a mistake is detected, DNA polymerase will act as an exonuclease and excise the incorrect nucleotide. A. What supplies the energy needed to add the new nucleotide to the existing chain? B. Please explain why evolution has favored 5’ to 3’ polymerases, as opposed to...