Can the exact same sequence of amino acids fold into different tertiary structures?

Expert Solution

The teriary structure of proteins are the result of interaction between different amino acids in the peptide and depends on multiple environmental factors such as pH or the presence of reducing agents which would break the disulphide bonds. Also, if there are multiple sites for disulphide bond formation, formation of one disulphide bond could prevent disulphide bond formation between certain other locations. Also, if the pH changes, the ionization on the amino acids also change, thereby affecting the tertiary structure. The shape of the active sites of certain enzymes which have an induced fit or allosteric modulation also change upon substrate binding or binding of the as allosteric activator or inhibitor.

Therefore, it is not only the peptide sequence but multiple environmental factors that determine the tertiary structure of proteins and so the same peptide sequence could exist in different tertiary structure depending on the interactions present.

gladiator answered 1 year ago

Proteins are chains of amino acids. There are twenty different types of naturally occurring amino acids,...

Proteins are chains of amino acids. There are twenty different types of naturally occurring amino acids, and all organisms must have all twenty of them in order to survive. In this project we will be discussing the amino acid leucine. What are the two possible methods that a cell may employ to be certain that it has each of the 20 amino acids? RNA is partly made of the base uracil. What are the two possible methods that a cell...

Common proteins are polymers of 20 different amino acids. How many amino acids are necessary for...

Common proteins are polymers of 20 different amino acids. How many amino acids are necessary for a protein polymer to have at least as many possible different sequences as there are atoms in the Universe? (There are about 2 × 1056 moles of atoms in the Universe.) *Note - The answer is a mathmatical answer. I need an explanation of the math behind this problem.

1.The same amino acid sequence protein produced in bacteria can have different bioactivity than when produced...

1.The same amino acid sequence protein produced in bacteria can have different bioactivity than when produced in mammalian cells. Explain why. 2.Carbohydrate conversion to energy that cells can use has a component that occurs in the cell cytoplasm and a part that occurs in the mitochondria. In cancer cells, how does this get altered?

How many different primary structures could be formed using the four amino acids alanine, phenylalanine, serine...

How many different primary structures could be formed using the four amino acids alanine, phenylalanine, serine and valine? Write the amino acid sequences (using the three letter code) of all the possible peptides that begin with phenylalanine. You must use each amino acid once and only once in each peptide.

Weak interactions among amino acids that stabilize the tertiary structure of the protein include (list five):

List the sequence of structures that a single amino acid (initially in a protein molecule that...

List the sequence of structures that a single amino acid (initially in a protein molecule that you eat) goes through from the moment it passes your lips to when it ends up in a hepatocyte. Then explain what (if any) chemicals relevant to digestive physiology it is exposed to at each step and what happens to the protein and eventually protein fragments each step of the way.

Does all Nonpolar amino acids have the same titration curve?

What is the maximum number of amino acids that could result from the following mRNA sequence?...

What is the maximum number of amino acids that could result from the following mRNA sequence? 5′ AUGAGACCGUCG 3′ A. 0 B. 4 C. 7 D. 10

5. How could you take a protein with a known sequence of amino acids and use...

5. How could you take a protein with a known sequence of amino acids and use it to make an artificial gene?

1) How many amino acids long is the protein with the following sequence? 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’...

1) How many amino acids long is the protein with the following sequence? 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’ agattttacagtctacatttcacgtgtagtcatcagaatgagagtcaaaacattgttgag 5’ 2) Design a set of 6 base pair long primers that scientists could use to amplify the entire sequence of the gene in Q1 3) T/F. A base pair substitution (ie. a point mutation) that introduces a nonsense mutation could be introduced to the sequence encoding the protein in Q1.

Question