Question

In: Biology

The diagram below represents a hypothetical enzyme protein with 100 amino acids. The number scale indicates...

The diagram below represents a hypothetical enzyme protein with 100 amino acids. The number scale indicates the position of each amino acid. This enzyme is regulated by an allosteric inhibitor.

Amino Acid position number

0         10           20         30         40         50         60         70         80         90        100

I______I_______I______I______I______I______I______I______I______I______I

                          I<------------------>I                                    I<--------->I                                         

                                Active Site                                       Allosteric Site

  1. What would be the likely effect on this enzyme’s activity if there were three separate point deletion mutations in the codons for the amino acids between position 4 and 12? Justify your answer with a brief description.
  2. What would be the likely effect on this enzyme’s activity if there was a point insertion mutation in the codon for the amino acid at position 37? Justify your answer with a brief description
  3. What would be the likely effect on this enzyme’s activity if there was a substitution mutation in the third base in the codon for the amino acid at position 50? Justify your answer with a brief description.

Solutions

Expert Solution

a)

Three separate point deletion mutations in the codons between positions 4 and 12 would likely have no to very little effect on the function of the enzyme. This is because the occurrence of three separate point deletions would not affect the frame of the protein and since amino acids 4 to 12 are not in the active site nor in the allosteric region, this mutation would likely have very little effect on the activity of the enzyme.

b)

If there were a point insertion mutation in the codon for the amino acid at position 37, the protein would likely become non-functional. This is because position 37 is within the active site of the protein, and an insertion mutation at this site would cause the active site to become non-functional.

c)

A substitution mutation of the third base of the 50th codon would likely have no effect on protein function. This is because of two primary reasons:

1) The third base of a codon can often be mutated to another base without it affecting the amino acid sequence due to third base wobble.
2) Amino acid 50 is not involved in either the active site nor is it a part of the allosteric regulator binding of the protein, therefore a mutation of this codon is unlineky to impact fnction.


Related Solutions

A large protein of 1205 amino acids was produced errors of average 8 mistakes/200 amino acids....
A large protein of 1205 amino acids was produced errors of average 8 mistakes/200 amino acids. Calculate probability to produce protein with: No mutation Less than 2 mutations Exactly 3 mutations Give mathematical expression and the number used in these expressions.
A gene is composed of DNA and a protein is composed amino acids. Describe the steps...
A gene is composed of DNA and a protein is composed amino acids. Describe the steps involved in converting the information contained in a gene into a protein. **Please include and define all of the following terms in your description:** Ribosome, template strand, non-template strand, reading frame, complementary, tRNA, mRNA, start codon, stop codon, transcription factors, 5’ to 3’, translation, transcription, gene promoter, RNA polymerase
Write and describe about the important of Protein and Amino Acids Test in healthcare or industry....
Write and describe about the important of Protein and Amino Acids Test in healthcare or industry. Note: The report must not exceed 3 pages maximum (NOT include cover page and references), type of test, purposes and the important of the test with reliable references Write and describe about the important of Protein and Amino Acids Test in healthcare or industry. Note: The report must not exceed 3 pages maximum (NOT include cover page and references), type of test, purposes and...
Write and describe about the important of Protein and Amino Acids Test in healthcare or industry....
Write and describe about the important of Protein and Amino Acids Test in healthcare or industry. Note: The report must not exceed 3 pages minimum (NOT include references), type of test, purposes and the important of the test with reliable references subject biochemestry
protein molecules are polypetide chains are made up of amino acids in their phisologically functoning or...
protein molecules are polypetide chains are made up of amino acids in their phisologically functoning or native state these chains fold in a unique manner such that the nonpolar groups of the amino acids are usually burired in the interior region of the proteins where there is little or no contact with water. when a protein denatures the chain unfolds so that these non polar groups are exposed to water. a useful estimate of the changes of the thermodynamic quantities...
protein molecules are polypetide chains are made up of amino acids in their phisologically functoning or...
protein molecules are polypetide chains are made up of amino acids in their phisologically functoning or native state these chains fold in a unique manner such that the nonpolar groups of the amino acids are usually burired in the interior region of the proteins where there is little or no contact with water. when a protein denatures the chain unfolds so that these non polar groups are exposed to water. a useful estimate of the changes of the thermodynamic quantities...
5. How could you take a protein with a known sequence of amino acids and use...
5. How could you take a protein with a known sequence of amino acids and use it to make an artificial gene?
List the stabilizing forces at tertiary level of protein structure. An enzyme containing the amino aspartic...
List the stabilizing forces at tertiary level of protein structure. An enzyme containing the amino aspartic acid (pKa of the side chain = 3.65) and histidine (pKa of the side chain= 6) in the active (catalytic ) site has an optimal activity at a pH of 5.0. What is the major stabilizing force at the catalytic site? Using structures and 1-3 complete sentences, predict and explain what is expected to happen to the activity if the pH is increased to...
suggest how a protein might have been hydrolyzed to give the amino acids. keep in mind...
suggest how a protein might have been hydrolyzed to give the amino acids. keep in mind that this is made from human consumption.
1) How many amino acids long is the protein with the following sequence? 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’...
1) How many amino acids long is the protein with the following sequence? 5’ tctaaaatgtcagatgtaaagtgcacatcagtagtcttactctcagttttgtaacaactc 3’ 3’ agattttacagtctacatttcacgtgtagtcatcagaatgagagtcaaaacattgttgag 5’ 2) Design a set of 6 base pair long primers that scientists could use to amplify the entire sequence of the gene in Q1 3) T/F. A base pair substitution (ie. a point mutation) that introduces a nonsense mutation could be introduced to the sequence encoding the protein in Q1.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT