1. You start with a section of DNA that has the following Genetic Code: AUGUUUCCUCCCACAACGGCUUAA List...

1. You start with a section of DNA that has the following Genetic Code: AUGUUUCCUCCCACAACGGCUUAA List the primary structure of the protein. How does this primary structure impact the secondary and tertiary structure of the protein? Using the above sequence as a starting point, create an insertion mutation WITHOUT creating a frameshift mutation. How could this change the function of the protein?

Expert Solution

Note : Start codon and stop codon doesn't code for amino acid.

gladiator answered 2 years ago

During cell division, DNA undergoes replication. DNA is transcribed into mRNA and the genetic code is...

During cell division, DNA undergoes replication. DNA is transcribed into mRNA and the genetic code is translated into a polypeptide sequence. Out of these three processes, which is most likely to be the site a deletion, frameshift, insertion missense, nonsense, point and silent mutation or alteration occurred? Explain why you have chosen this process. 15 marks

We think of DNA as the stuff that stores the genetic code. It turns out that...

We think of DNA as the stuff that stores the genetic code. It turns out that DNA occurs, mainly outside living cells, on the ocean floor. It is important in nourishing seafloor life. Scientists think that this DNA comes from organic matter that settles to the bottom from the top layers of the ocean. "Phytopigments," which come mainly from algae, are a measure of the amount of organic matter that has settled to the bottom. The table contains data on...

Section 1 (3 marks: You can start this section after Week 4 lecture) Read the following...

Section 1 (3 marks: You can start this section after Week 4 lecture) Read the following article: Harford, T. (2014), ‘Big data: A big mistake?’, Significance 11(5), 14–19. Question: Critically evaluate the main points of the article using three bullet points, in less than 150 words in total. Critical evaluation means • To give your opinion on something • To support your opinion (with evidence where possible). • Note: Critiquing is NOT simply stating that something is “bad”. • Weigh...

What is the basic understanding of genetic heredity? Is DNA code must be understood but molecular...

What is the basic understanding of genetic heredity? Is DNA code must be understood but molecular details are not needed? What is the relation between genes, evolution, and natural selection? Is the distinction between learned behavioral adaptations and innate behavioral adaptations important? In this context, what meant by “3 sources of knowledge in behavior”? What are the basics of behavior genetics and the notion of the heritability estimates? Is gene-environment interactions are quite important as well?

Which statement is FALSE of the genetic code? a) it contains a list of codons and...

Which statement is FALSE of the genetic code? a) it contains a list of codons and the amino acids they code for which combine together to form proteins b) a total of 20 amino acids are coded for by more than 20 codons c) a codon 'word' consists of three nucleotides, and each codon codes for one amino acid d) different codons can code for the same amino acid, if they share the same first two nucleotides in the codon...

Link the genetic characteristics to the DNA structure and also list and describe Mendel's principles and...

Link the genetic characteristics to the DNA structure and also list and describe Mendel's principles and describe how each contribute to genetic variability. How might biology have be different if his discoveries had not been lost for decades? Be prepared to discuss the significance of Mendel's discoveries to moder biology.

Basic understanding of genetic heredity. DNA code must be understood but molecular details are not needed....

Basic understanding of genetic heredity. DNA code must be understood but molecular details are not needed. Relation between genes, evolution, and natural selection. The distinction between learned behavioral adaptations and innate behavioral adaptations is important. In this context, what we have meant by “3 sources of knowledge in behavior” is crucial. Basics of behavior genetics and the notion of the heritability estimates. Gene-environment interactions are quite important as well.

In python The following is a short section of genomic DNA: ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGATCGATCGATCGATCGATCGATCATGCTATCATCGATCGATATCGATGCATCGACTACTAT 1. It comprises two...

In python The following is a short section of genomic DNA: ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGATCGATCGATCGATCGATCGATCATGCTATCATCGATCGATATCGATGCATCGACTACTAT 1. It comprises two exons and an intron. The first exon runs from the start of the sequence to base number 63 (starting counting from zero), and the second exon runs from base 91 (also counting from zero) to the end of the sequence. Write a program that will print just the coding regions of the DNA sequence. 2. Using the data from part one, write a program...

Section 1.You must use sub-queries to answer section 1questions.Q1: List the length of the...

Section 1. You must use sub-queries to answer section 1 questions. Q1: List the length of the longest track in the 'metal' genre. Q2: List the artistid, artistname and entrydate of all artists whose entrydate is earlier than everyone who has a 'directmail' leadsource. Q3: List the artistid, artistname and entrydate of all artists whose entrydate is earlier than anyone who has a 'directmail' leadsource. Q4: List the artistname and entrydate of the artist with the earliest entry date. Q5: ...

The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the...

The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the sequences below would most likely bind to this sequence to initiate DNA replication through the formation of RNA ? A. 5′—TTAACGTCTAAGT—3′ B. 3′—TTAACGTCTAAGT—5′ C. 3′—UUAACGUCUAAGU—5′ D. 5′—UUAACGUCUAAGU—3′

Question