Question

In: Economics

Section 1 (3 marks: You can start this section after Week 4 lecture) Read the following...

Section 1 (3 marks: You can start this section after Week 4 lecture) Read the following article: Harford, T. (2014), ‘Big data: A big mistake?’, Significance 11(5), 14–19. Question: Critically evaluate the main points of the article using three bullet points, in less than 150 words in total. Critical evaluation means • To give your opinion on something • To support your opinion (with evidence where possible). • Note: Critiquing is NOT simply stating that something is “bad”. • Weigh up strengths and weaknesses. • Appraise the worth of something - test assumptions - judge the worth of an argument or position. Your points of evaluation may include the following (but not limited to): • Correlation vs. causation • Importance of theories or insights in statistical analysis • Multiple testing problem • Sampling error • Sampling bias • Big data hubris In providing your answers, you can also refer to the contents of Lecture in Week 4 (Statistical Significance in Empirical Research)

Solutions

Expert Solution

If i try to be a critic for Harford article "Big data: A big mistake i'll straight get into the point that its an act of balancing threats & malwares if big data arent safely handled. There is always big risks to the social media giants for data leaks by many other hackers the way at present CHINA is blamed for secretly keeping a watch over other countries data by the use of certain apps .These are some of data theft ususally happening due to mishandling of data security by the IT cyber cell professionals of the country it self it can be well understood by following certain points on which there are problem being faced heavily :-

Despite key advances such as growing pool of data scientists some critical data mistake still persists for critics like

1)Poor Data Quality:- if we go for using data of low kbps or older versions that can be easily traced or tracked & hackable by the intruders which is basically good  critic point to discuss

2)Too Much Data - data in bulk is also a problem as it requires more amount of servers to manage it like if we say FACEBOOK has to handle lots of data of the whole world at a single minute or second for that there cant be a single mistake to be left on managerial staffs of the firm .Its the head who will be responsible for data bulk management

3)Assuming event prediction is a slam dunk- predictive analytics is an existing made possible by lot because of its persived value to business good for stake holders but predictive analysis is not possible in all instances. Cos first ther has to be a projected claer basis.

4)Overpromising what data scientists can deliver:- there cant be just vague target & no achievement of those in a particular time it affects the firms burocrasy. Only the actual promised work for data should be delivered .


Related Solutions

Unit 4: Discussion - Part 1 Question Read the lecture for Chapter 4, and then answer...
Unit 4: Discussion - Part 1 Question Read the lecture for Chapter 4, and then answer the following: Think of a brief example where you can use conditional statements and write it in correct Java syntax. You may use if-else-if statements or the switch statement. You may also use the example you wrote in pseudo code for the discussion thread 2 during week 2 and convert it to Java, if you think it is appropriate. Be mindful that we are...
Question 2 (11 marks) (This question is from the Week 3 and Week 4 Tutorials) Sally...
Question 2 (This question is from the Week 3 and Week 4 Tutorials) Sally has $50 000. She wants to save $120 000 to deposit for her first home loan. She decided to put that $50 000 in an investment fund that pays an interest rate of 11% per annum (per year), compounding annually. Required: a. How long does she need to wait until she has saved $120 000? b. If Sally wishes to have that $120 000 in five...
Question 4 [40 Marks] You have seven mornings per week. On each morning, you can either...
Question 4 [40 Marks] You have seven mornings per week. On each morning, you can either study, go to the rock climbing wall, or sculpt (i.e., make sculptures). If you rock climb, you must be a member of the club. The membership fee is 100 Bobos each week. And, as member, you pay 10 Bobos for each morning of climbing. If you sculpt, you must rent a studio which costs 100 Bobos per month. Each morning you sculp, you use...
1. You start with a section of DNA that has the following Genetic Code: AUGUUUCCUCCCACAACGGCUUAA List...
1. You start with a section of DNA that has the following Genetic Code: AUGUUUCCUCCCACAACGGCUUAA List the primary structure of the protein. How does this primary structure impact the secondary and tertiary structure of the protein? Using the above sequence as a starting point, create an insertion mutation WITHOUT creating a frameshift mutation. How could this change the function of the protein?
estion 1 (7 marks) (This question is from the Week 3 Tutorial) You have reviewed the...
estion 1 (This question is from the Week 3 Tutorial) You have reviewed the work performed by your assistant, Raymond Snow, on the audit of Tin Ltd for the year ended 30 June 20X8 and you have noted the following two independent matters: (i) In testing investments in listed securities, Raymond selected all shareholdings with a market value above $200,000 and checked them to the closing market value reported by the Australian Stock Exchange (ASX) to determine the net realisable...
Question 1 (7 marks) (This question is from the Week 3 Tutorial) You have reviewed the...
Question 1 (This question is from the Week 3 Tutorial) You have reviewed the work performed by your assistant, Raymond Snow, on the audit of Tin Ltd for the year ended 30 June 20X8 and you have noted the following two independent matters: (i) In testing investments in listed securities, Raymond selected all shareholdings with a market value above $200,000 and checked them to the closing market value reported by the Australian Stock Exchange (ASX) to determine the net realisable...
WEEK 4 DISCUSSION #3 ANSWER THE FOLLOWING QUESTIONS BELOW: 1: Do you need to identify and...
WEEK 4 DISCUSSION #3 ANSWER THE FOLLOWING QUESTIONS BELOW: 1: Do you need to identify and manage every risk to an organization or are there risks that don’t matter? Explain why or why not and provide cases for each. 2: Read “Envisioning Risk – A Systematic Framework for Risk Visualization in Risk Management and Communication Why or why not it is important to be able to visualize risk? How can it help an organization understand risk?
In our lecture this week we read about slotting fees, fees that manufacturers pay retailers to...
In our lecture this week we read about slotting fees, fees that manufacturers pay retailers to stock their product on their shelves. Is this legal? Ethical?
SECTION A (30 marks) This section consists of ONE (1) compulsory question QUESTION 1 (30 marks)...
SECTION A This section consists of ONE (1) compulsory question QUESTION 1 ABC Ltd is a wholesaler of furniture which has been in operation for ten years. It buys furniture from five major manufacturers and sells them to a range of customers. The company currently has a customer base of over 500 customers most of which are credit customers. The receivables balance comprises customers owing up to $2,000,000 to smaller balances of about $10,000, all with many different due dates...
Section 2 - CASE ANALYSIS (30 marks) INSTRUCTIONS: 1. Read the case below carefully and answer...
Section 2 - CASE ANALYSIS INSTRUCTIONS: 1. Read the case below carefully and answer ALL the questions which follow. 2. Your answers may be entered using a Microsoft Excel spreadsheet OR may be entered in a table format using Microsoft Word. HEALTHY OPTIONS INC. Healthy Options is a Pharmaceutical Company which is considering investing in a new production line of portable electrocardiogram (ECG) machines for its clients who suffer from cardiovascular diseases. The company has to invest in equipment which...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT