Question

In: Biology

Which statement is FALSE of the genetic code? a) it contains a list of codons and...

Which statement is FALSE of the genetic code?

a) it contains a list of codons and the amino acids they code for which combine together to form proteins

b) a total of 20 amino acids are coded for by more than 20 codons

c) a codon 'word' consists of three nucleotides, and each codon codes for one amino acid

d) different codons can code for the same amino acid, if they share the same first two nucleotides in the codon

e) the third nucleotide in the codon needs to be precise for the correct amino acid according to the wobble hypothesis

What is natural hybridization between species?

a) the process of producing DNA clones by inserting the genes from one species into another

b) the process of individuals from dissimilar groups mating and forming viable offspring

c) the process of individuals that are genetically identical mating and creating genetically variable offspring

d) the process of amplifying small regions of DNA into millions of copies within a short period of time

e) none of these are true

After the process of meiosis is completed to form sperm and egg cells, they come together to created fertilized human cell which is..

a) diploid

b) haploid

c) a zygote

d) triploid

e) both A & C

What is NOT a physical characteristic of DNA?

a) double helix

b) antiparallel

c) complimentary base pairing

d) single stranded

e) has thymine bases

What is the direction of the flow of information within cells?

a) proteins, RNA, DNA

b) DNA, proteins, RNA

c) DNA, RNA, proteins

d) RNA, DNA, proteins

What is the difference between restriction enzymes (REs) and polymerase chain reaction (PCR)?

a) REs are used to create millions of copies of DNA, PCR is involved in inserting DNA from one place to another

b) REs are used in cell regeneration, PCR is used in inserting fragments into bacterial plasmids

c) REs help cut DNA into smaller fragments, PCR is used to transfer foreign DNA from viruses

d) RE's cut DNA at specific sequences of nucleotides, PCR is used to amplify a certain section of DNA into millions of copies

e) RE's use the Cas-9 enzyme, PCR uses the CRISPR enzyme

In fruit flies, eye color is a sex-linked gene, where red color is dominant to the mutation causing white eyes. If a red-eyed male mated with a white-eyed female, what will the phenotypes of the offspring be?

a) all of the females will have red eyes, all the males will have white

b) all of the females will have white eyes, all of the males with have red

c) all of the offspring will have red eyes

d) all of the offspring will have white eyes

Which is TRUE of a DNA mutation?

a) is a change in the nucleotide sequence

b) always results in a change in the protein

c) may change the protein IF the change in nucleotide sequence occurs inside of a gene AND changes the amino acid of a codon

d) all of the above

e) A & C only

True or False: DNA methylation is a type of epigenetic change which can alter gene expression, even though there is no mutation in the genetic sequence itself.

Solutions

Expert Solution

1.     Which statement is FALSE of the genetic code?

e) the third nucleotide in the codon needs to be precise for the correct amino acid according to the wobble hypothesis

Reason: Postion of third code called wobble position is not important to decide amino acid it codes for.

2.     What is natural hybridization between species?

b) the process of individuals from dissimilar groups mating and forming viable offspring

Reason: Hybridization produces offspring having traits of dissimilar mating parents.

3.     After the process of meiosis is completed to form sperm and egg cells, they come together to created fertilized human cell which is..

a)     diploid

c)     a zygote

e) both A & C

Reason: Zygote is diploid cell that is result of fertlisation.

d)     What is NOT a physical characteristic of DNA?

d) single stranded

Reason: DNA shows antiparallel, Complementary and double helical structure. It is usually not single stranded.

e)     What is the direction of the flow of information within cells?

c) DNA, RNA, proteins

f)      What is the difference between restriction enzymes (REs) and polymerase chain reaction (PCR)?

d) RE's cut DNA at specific sequences of nucleotides, PCR is used to amplify a certain section of DNA into millions of copies

g)     In fruit flies, eye color is a sex-linked gene, where red color is dominant to the mutation causing white eyes. If a red-eyed male mated with a white-eyed female, what will the phenotypes of the offspring be?

b) all of the females will have white eyes, all of the males with have red

XR

Y

X

X XR

XY

X

X XR

XY

Red eye Female

White male

h)    Which is TRUE of a DNA mutation?

a.      is a change in the nucleotide sequence

c)     may change the protein IF the change in nucleotide sequence occurs inside of a gene AND changes the amino acid of a codon

e) A & C only


Related Solutions

What is the genetic code? What are the properties of the triplet codons? What does it...
What is the genetic code? What are the properties of the triplet codons? What does it mean that the code is redundant and what useful purpose does such redundancy serve?
translation: Genetic code; codon. How many codons are there? How many code for amino acids? What...
translation: Genetic code; codon. How many codons are there? How many code for amino acids? What do the others do? What is the genetic code? tRNA; anticodon; aminoacyl-tRNA synthetase. What key role do aminoacyl-tRNA synthetases play in translation? Why is there more than one? Ribosome structure. What are ribosomes made of? Where are they made? Why are there 3 tRNA binding sites? Translation initiation complex Why wouldn't a transcribed mRNA not be translated immediately? Elongation & translocation in translation. In...
a) Explain what is meant by the statement “the genetic code is degenerate”. Why it is...
a) Explain what is meant by the statement “the genetic code is degenerate”. Why it is advantageous for the code to be degenerate? b) How is it possible that some tRNA molecules recognize more than one codon?
explain what is meant by the statement the genetic code is degenerate . why is it...
explain what is meant by the statement the genetic code is degenerate . why is it advantageous for the code to be degenarate?
Which statement is false?
Which statement is false? A Every square is a parallelogram B Some rhombuses are rectangles C Every rhombus is a quadrilateral D Every parallelogram is a rhombus
Which of the following statement is false?
Which of the following statement is false?Dividends are not an expense of the company.Dividends are defined in s 6(1) of ITAA 1936.All shareholders are automatically entitled to franking credits attached to a franked distribution of profit.A dividend includes any amount credited by a company to its shareholders as shareholders.
Explain the meaning of genetic code, and describe how the genetic code functions. a. Explain the...
Explain the meaning of genetic code, and describe how the genetic code functions. a. Explain the one gene-one polypeptide theory. b. The DNA sequence of a gene determines the sequence of amino acids in a polypeptide chain. What studies have demonstrated this relationship? c. In what molecule are codons found? How many nucleotides are in each codon? How many nucleotides are available to make up each codon? How many different types of codons are possible? How many amino acids are...
1. You start with a section of DNA that has the following Genetic Code: AUGUUUCCUCCCACAACGGCUUAA List...
1. You start with a section of DNA that has the following Genetic Code: AUGUUUCCUCCCACAACGGCUUAA List the primary structure of the protein. How does this primary structure impact the secondary and tertiary structure of the protein? Using the above sequence as a starting point, create an insertion mutation WITHOUT creating a frameshift mutation. How could this change the function of the protein?
what are the genetic code rules
what are the genetic code rules
Choose the FALSE statement: A)The Hox genes represent an example of genes that code for process...
Choose the FALSE statement: A)The Hox genes represent an example of genes that code for process rather than product; their significance to the Cambrian explosion is that bilateral symmetry did not have to evolve independently in each animal group, rather all Cambrian phyla could evolve quickly based on this homology. B) The Galapagos finches represent an example of microevolutionary change; recent evidence has shown that such changes occur much faster than Darwin ever imagined. C) Modern molecular biology has shown...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT