Question

In: Statistics and Probability

We think of DNA as the stuff that stores the genetic code. It turns out that...

We think of DNA as the stuff that stores the genetic code. It turns out that DNA occurs, mainly outside living cells, on the ocean floor. It is important in nourishing seafloor life. Scientists think that this DNA comes from organic matter that settles to the bottom from the top layers of the ocean. "Phytopigments," which come mainly from algae, are a measure of the amount of organic matter that has settled to the bottom. The table contains data on concentrations of DNA and phytopigments in grams per square meter in 116 ocean locations around the world. Examine the relationship between DNA and phytopigments.

DNA and phytopigment concentrations (g/m2) on the ocean floor
DNA Phyto DNA Phyto DNA Phyto DNA Phyto DNA Phyto DNA Phyto
0.148 0.010 0.276 0.056 0.156 0.032 0.300 0.022 0.344 0.009 0.090 0.003
0.108 0.009 0.214 0.023 0.112 0.016 0.116 0.008 0.464 0.030 0.206 0.001
0.180 0.008 0.330 0.016 0.280 0.005 0.120 0.004 0.538 0.055 0.307 0.001
0.218 0.006 0.240 0.007 0.308 0.005 0.064 0.006 0.153 0.001 0.552 0.040
0.152 0.006 0.100 0.006 0.238 0.011 0.228 0.010 0.095 0 0.168 0.005
0.589 0.050 0.463 0.038 0.461 0.034 0.333 0.020 0.901 0.075 0.112 0.003
0.357 0.023 0.382 0.032 0.414 0.034 0.241 0.012 0.116 0.003 0.179 0.002
0.458 0.036 0.396 0.033 0.307 0.018 0.236 0.002 0.132 0.005 0.264 0.026
0.076 0.001 0.001 0.002 0.009 0 0.099 0 0.302 0.014 1.056 0.082
0.187 0.001 0.104 0.004 0.088 0.009 0.072 0.002 0.360 0.010 0.207 0.001
0.192 0.005 0.152 0.028 0.152 0.006 0.272 0.004 0.296 0.010 0.131 0.001
0.288 0.046 0.232 0.006 0.368 0.003 0.216 0.011 0.130 0.001 0.822 0.058
0.248 0.006 0.280 0.002 0.336 0.062 0.320 0.006 0.172 0.001 0.172 0.006
0.896 0.055 0.200 0.017 0.408 0.018 0.472 0.017 0.171 0.001 0.100 0.001
0.648 0.034 0.384 0.008 0.440 0.042 0.592 0.032 0.391 0.026 0.168 0.001
0.392 0.036 0.312 0.002 0.312 0.003 0.208 0.110 0.074 0 0.213 0.007
0.128 0.001 0.264 0.001 0.264 0.008 0.328 0.010 0.121 0.004
0.264 0.002 0.376 0.003 0.288 0.001 0.208 0.024 0.369 0.023
0.224 0.017 0.376 0.010 0.600 0.024 0.168 0.014 0.184 0.010
0.264 0.018 0.152 0.101 0.184 0.016 0.312 0.017 0.328 0.028

SOLVE: Use software of your choice to make a scatterplot using the data. Then find the ?‑intercept, ?,and the slope, ? for the least‑squares regression line. (Enter your answers rounded to four decimal places.)

?=

?=

Find the square of the correlation. (Enter your answer rounded to three decimal places.)

?2=

Solutions

Expert Solution


Related Solutions

During cell division, DNA undergoes replication. DNA is transcribed into mRNA and the genetic code is...
During cell division, DNA undergoes replication. DNA is transcribed into mRNA and the genetic code is translated into a polypeptide sequence. Out of these three processes, which is most likely to be the site a deletion, frameshift, insertion missense, nonsense, point and silent mutation or alteration occurred? Explain why you have chosen this process. 15 marks
What is the basic understanding of genetic heredity? Is DNA code must be understood but molecular...
What is the basic understanding of genetic heredity? Is DNA code must be understood but molecular details are not needed? What is the relation between genes, evolution, and natural selection? Is the distinction between learned behavioral adaptations and innate behavioral adaptations important? In this context, what meant by “3 sources of knowledge in behavior”? What are the basics of behavior genetics and the notion of the heritability estimates? Is gene-environment interactions are quite important as well?
why do you think some mutations are Silent in the genetic code
why do you think some mutations are Silent in the genetic code
1. You start with a section of DNA that has the following Genetic Code: AUGUUUCCUCCCACAACGGCUUAA List...
1. You start with a section of DNA that has the following Genetic Code: AUGUUUCCUCCCACAACGGCUUAA List the primary structure of the protein. How does this primary structure impact the secondary and tertiary structure of the protein? Using the above sequence as a starting point, create an insertion mutation WITHOUT creating a frameshift mutation. How could this change the function of the protein?
Basic understanding of genetic heredity. DNA code must be understood but molecular details are not needed....
Basic understanding of genetic heredity. DNA code must be understood but molecular details are not needed. Relation between genes, evolution, and natural selection. The distinction between learned behavioral adaptations and innate behavioral adaptations is important. In this context, what we have meant by “3 sources of knowledge in behavior” is crucial. Basics of behavior genetics and the notion of the heritability estimates. Gene-environment interactions are quite important as well.
Explain the meaning of genetic code, and describe how the genetic code functions. a. Explain the...
Explain the meaning of genetic code, and describe how the genetic code functions. a. Explain the one gene-one polypeptide theory. b. The DNA sequence of a gene determines the sequence of amino acids in a polypeptide chain. What studies have demonstrated this relationship? c. In what molecule are codons found? How many nucleotides are in each codon? How many nucleotides are available to make up each codon? How many different types of codons are possible? How many amino acids are...
what are the genetic code rules
what are the genetic code rules
Discuss how DNA was discovered to be the genetic material
Discuss how DNA was discovered to be the genetic material
What are silent mutations? From your knowledge of the genetic code, why do you think most...
What are silent mutations? From your knowledge of the genetic code, why do you think most silent mutations affect the third position in a codon. Provide your answer with the 64 universal genetic code table.
Genetic Code: Using the standard genetic code, write a sequence encoding the peptide "MASTERMIX" How many...
Genetic Code: Using the standard genetic code, write a sequence encoding the peptide "MASTERMIX" How many different sequences can encode this peptide? How many genetic codes have been described? (Hint: search NCBI Genetic Codes) How, in a general way, do these alternative codes tend to differ from the standard genetic code? How is selenocysteine encoded?
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT