Question

In: Biology

I have a one strand DNA sequence that I am trying to determine the base pairs...

I have a one strand DNA sequence that I am trying to determine the base pairs for. The gene is CYP1A2 and the primers and sequence are below.

Below is the sequence of part of the CYP1A2 gene (you are given only 1 strand, written in the 5’ – 3’ direction).

5’TGGGCTAGGTGTAGGGGTCCTGAGTTCCGGGCTTTGCTACCCAGCTCTTGACTTCTGTTTCCCGATTTTA

AATGAGCAGTTTGGACTAAGCCATTTTTAAGGAGAGCGATGGGGAGGGCTTCCCCCTTAGCACAAGGGCA

GCCCTGGCCCTGGCTGAAGCCCAACCCCAACCTCCAAGACTGTGAGAGGATGGGGACTCATCCCTGGAGG

AGGTGCCCCTCCTGGTATTGATAAAGAATGCCCTGGGGAGGGGGCATCACAGGCTATTTGAACCAGCCCT

GGGACCTTGGCCACCTCAGTGTCACTGGGTAGGGGGAACTCCTGGTCCCTTGGGTATATGGAAGGTATCA

GCAGAAAGCCAGCACTGGCAGGGACTCTTTGGTACAATACCCAGCATGCATGCTGTGCCAGGGGCTGACA

AGGGTGCTGTCCTTGGCTTCCCCATTTTGGAGTGGTCACTTGCCTCTACTCCAGCCCCAGAAGTGGAAAC

TGAGATGATGTGTGGAGGAGAGAGCCAGCGTTCATGTTGGGAATCTTGAGGCTCCTTTCCAGCTCTCAGA

TTCTGTGATGCTCAAAGGGTGAGCTCTGTGGGCCCAGGACGCATGGTAGATGGAGCTTAGTCTTTCTGGT

ATCCAGCTGGGAGCCAAGCACAGAACACGCATCAGTGTTTATCAAATGACTGAGGAAATGAATGAATGAA

TGTCTCCATCTCAACCCTCAGCCTGGTCCCTCCTTTTTTCCCTGCAGTTGGTACAGATGGCATTGTCCCA

GTCTGTTCCCTTCTCGGCCACAGAGCTTCTCCTGGCCTCTGCCATCTTCTGCCTGGTATTCTGGGTGCTC

AAGGGTTTGAGGCCTCGGGTCCCCAAAGGCCTGAAAAGTCCACCAGAGCCATGGGGCTGGCCCTTGCTCG

GGCATGTGCTGACCCTGGGGAAGAACCCGCACCTGGCACTGTCAAGGATGAGCCAGCGCTACGGGGACGT

CCTGCAGATCCGCATTGGCTCCACGCCCGTGCTGGTGCTGAGCCGCCTGGACACCATCCGGCAGGCCCTG 3’

The sequences of the primers used to amplify part of the CYP1A2 gene are as follows:

Forward primer: 5’ GAGAGCGATGGGGAGGGC 3’

Reverse primer: 5’ CCCTTGAGCACCCAGAATACC 3’

The restriction enzyme ApaI recognises and cleaves the sequence GGGCC^C (^ indicates where the DNA is cleaved).

I need to determine the fragment sizes for the alleles AA, AC and CC. I believe I have worked out AA (766bp) and CC as (507bp + 259bp), but am stuck on AC

Solutions

Expert Solution

GGTATTCTGGGTGCTCAAGGG

Okay, so in this gene, the allele A is known by mutating the final C in the sequence recognized (GGGCC^C) by the Apal restriction enzyme. If this final C is changed to an A, the enzyme cannot recognize the site and won't cleave. The the allele C will produce a cleaved sequence and thus 2 fragments, while the allele A will prevent the cleavage and produce a single fragment. Let's first highlight the sequence that will be amplified by the PCR using the primers:

Now you can see the primers drawn as rectangles in the proper location, and the red rectangle is the location of the sequence cleaved by the enzyme.

Let's analyse the genotypes:

- AA: This genotype has two alleles that won't cleave in the test, the fragment will have the full size from the PCR products. That is fragments that are 744 pb long.

- CC: This genotype has two alleles that will actually cleave in the test, the fragments will have a reduced size, the first half will be 493 pb long, and the second half will be 251 pb long.

- AC: This genotype includes one allele that will be cleaved and another that won't. So we will find the 3 fragments: 744 pb, 493 pb and 251 pb.


Related Solutions

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown...
Write down the DNA base sequence that is the complementary strand to the DNA sequence shown below? (5') C G A C T T C G A G C T (3')
One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the...
One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures?
During transcription, the strand of DNA that base pairs with the new mRNA is called the:...
During transcription, the strand of DNA that base pairs with the new mRNA is called the: a) Parental strand b) Template strand c) Nontemplate strand d) Coding strand
1. One strand of a double-helical DNA has the sequence 5¢-GCGCAATATTTCTCAAAATATTGCGC-3¢. Write the base sequence of...
1. One strand of a double-helical DNA has the sequence 5¢-GCGCAATATTTCTCAAAATATTGCGC-3¢. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures?   2. Compositional analysis of a certain lipid shows that it has exactly one mole of fatty acid per mole of inorganic phosphate. What could be the identify of this lipid? Explain.
If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?
If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?
If one strand of the DNA has the sequence of AGCTTC what will be the other...
If one strand of the DNA has the sequence of AGCTTC what will be the other strand be ? A DNA nucleotide consists of Small extrachromosoal pieces of DNA found in prokaryotes which replicate independently of the of the chromosome and provide the cell with different traits are Codons are recognized during The role of translation is to
Write sequence of the DNA strand that would be complementary to the DNA sequence shown below....
Write sequence of the DNA strand that would be complementary to the DNA sequence shown below. Label the 3' and 5' ends ofthe new strand. 3'   T A C C G A T G G    5'
1) The WILDTYPE DNA/gene has the base sequence:    5’GTACTGCAT3’ (the antisense strand of the gene is...
1) The WILDTYPE DNA/gene has the base sequence:    5’GTACTGCAT3’ (the antisense strand of the gene is shown) The gene has undergone a mutation. The mutant DNA/gene has the base sequence: 5’GTACTCCAT3’ (the mutation is in BOLD) based on this information, answer the following 1a)What is the base sequence of mutant mRNA? Label the ends of the mRNA 1b) this mutation is most likely to be caused by: a. soot b. analogues c. X-Ray d. RNA polymerase e. ribosome (pick one)...
Below is a DNA sequence of Borrelia burgdorferi containing the sequence of one strand only. 5’-ACTTCAGGATCCACTGGGCCCGAATTCGTCCTGAGCTCTAGAGTCCTTCG-3’...
Below is a DNA sequence of Borrelia burgdorferi containing the sequence of one strand only. 5’-ACTTCAGGATCCACTGGGCCCGAATTCGTCCTGAGCTCTAGAGTCCTTCG-3’ A) Please make the DNA double stranded by writing the complementary strand of the DNA underneath the strand above. B) Find in internet restriction sites for BamHI, EcoRI and XbaI. Please place a box around each restriction site in the DNA. C) You choose to cut this DNA with all three restriction enzymes.  How many DNA fragments will you get? D) You choose to cut...
Consider a three-base sequence within the coding region in the DNA template strand: 5'-...123...-3', in which...
Consider a three-base sequence within the coding region in the DNA template strand: 5'-...123...-3', in which 1, 2, and 3 refer to the relative positions of deoxyribonucleotides within a codon. What would be the effects of a point mutation that would change a purine for a pyrimidine at position 2? 1. (True/False) This mutation will always result in an altered amino acid sequence in the mutant protein compared to the original protein. 2. (True/False) The mutant amino acid, if changed,...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT