Question

In: Physics

Directions: Write the value and uncertainty in the proper “presentation format”. (1) Round off uncertainty to...

Directions: Write the value and uncertainty in the proper “presentation format”. (1) Round off uncertainty to two (2) significant figures (2) Round off value to same decimal place as last significant digit in uncertainty (3) When using scientific notation, make sure value and uncertainty are expressed to same power of ten, with decimal point placed after first digit in the value. Example: (5.423 ± 0.034) x 10-5 (4) Hint: If your value is greater than 10,000 or less than 0.01 you must use scientific notation. Note on Grading: This sheet must be done perfectly to receive an 8/10. If this second version is not done perfectly, then you will be given a new version, and if that one is completed perfectly then you will receive a 7/10. You will continue to lose points until this sheet is completed perfectly. See lab manual for details on presentation format.

# Value Uncertainty    Presentation Format (Value ± Uncertainty)

1 7.286277704 0.035965099

2 1.681735783 0.005686618

3 61.3568665 0.981143685

4 2690973.876 48907.07815

5 1.75447E-06 1.87125E-07

6 6.165959668 0.320999526

7 0.000861333 1.32518E-05

8 1.05259E-05 1.66169E-07

9 0.002142297 5.56807E-05

10 1.41859E-06 3.87179E-08

Solutions

Expert Solution


Related Solutions

Perform the following calculations and round off the answers to proper significant figures: 1. 9.82 ml...
Perform the following calculations and round off the answers to proper significant figures: 1. 9.82 ml + 10.0 ml + 9.980 ml = 2. (62.927 g/ml)(10.0 ml) = Show calculation work
For this section, write the proper anatomical planes and directions? 1. Stand (or imagine yourself standing)...
For this section, write the proper anatomical planes and directions? 1. Stand (or imagine yourself standing) in standard anatomical position. Which plane divides your body into left and right halves? 2. Relative to your sternum, where is your cranium positioned? Your second thoracic vertebra? 3. Relative to your sacrum, where is your ilium positioned? Your femora? 4. Relative to your humerus, where is your ulna positioned? Your scapula?
1) You sent off a sample for sequencing in order to aid in prescribing the proper...
1) You sent off a sample for sequencing in order to aid in prescribing the proper treatment and got the following sequence back: a. TGGATTATGCGATGTCGGTCATTTTGGACCGGGCTTTGCGCATATCGCAGACGGTTTAAAGCCCGTCCAGCGTCGAATCGTGTACGCCATGTCAGAATTGGGTTTAAAATCAACCGCTAAGTATAAGAAATCAGCGCGGACGGTAGGCGACGTTTTGGGTAAATTCCATCCGCACGGAGACACCGCCTGTTACGAGGCCATGGTATTGATGGCCCAACCTTTTTCATTTCGCTATCCCTTTGTCGATGGGCAAGGCAATTGGGGGAGCGCGGATGATCCC AAATCCTTTGCCGCCATGCGTTATACGGAAGCACGTCTG b. Describe the complete process, step by step, that this protein plays a role in. 2)Use an online tool to transcribe and translate the sequence and paste below. Describe how that would be done inside the cell of the pathogen in detail. 3)E.coli has a glutamine at position 87 in this protein. Our pathogen...
Due: 07/25/2018 Bonus Assignment #1 Directions: For this bonus assignment, you will give a presentation on...
Due: 07/25/2018 Bonus Assignment #1 Directions: For this bonus assignment, you will give a presentation on a statistical model of your choosing. To do this, choose a statistical model from the list below and come up with a hypothetical study related to your research interests that could be conducted using the model. Presentations should be 5-6 minutes and must include the following: Background information on your topic, research question/hypothesis, and why you think your study should be conducted. State the...
write value of PI(3.14159) in IEEE-754 single-precision format
write value of PI(3.14159) in IEEE-754 single-precision format
1. Arrange the following items in proper balance sheet presentation: Accumulated depreciation................................................ $200,000 Retained earnings................................................................... 110,000...
1. Arrange the following items in proper balance sheet presentation: Accumulated depreciation................................................ $200,000 Retained earnings................................................................... 110,000 Cash................................................................................. ..............5,000 Bonds payable.......................................................................... 142,000 Accounts receivable.................................................................38,000 Plant and equipment—original cost.................................. 720,000 Accounts payable.......................................................................35,000 Allowance for bad debts............................................................6,000 Common stock, $1 par, 150,000 shares outstanding...150,000 Inventory...................................................................................... .66,000 Preferred stock, $50 par, 1,000 shares outstanding.....50,000 Marketable securities.................................................................15,000 Investments.................................................................................. . .20,000 Notes payable..................................................................................83,000 Capital paid in excess of par (common stock)......................88,000 2. Elite Trailer Parks has an operating profit or $200,000. Interest expense for the year...
ROUND OFF ANSWERS TO 2 DECIMAL PLACES AND GIVE UNITS. 1. Determine the range and standard...
ROUND OFF ANSWERS TO 2 DECIMAL PLACES AND GIVE UNITS. 1. Determine the range and standard deviation of the following prices of selected digital cameras. $158, $95 ,$175, $180 ,$95,$129, $228, $300 2. 7 employees at a large company were asked the number of additional years they planned to work before retirement. Their responses were 10, 23, 28,4,1,6,12 Determine the range and standard deviation of the number of years. 3. The standard deviation of a set of data in which...
Write a C program that takes a double value and rounds it up or off using...
Write a C program that takes a double value and rounds it up or off using ternary expression in the program. Example, if -2.5 is inputted the value should give -3.0
Directions: Write a response of at least 30 words each to the following questions. 1. What...
Directions: Write a response of at least 30 words each to the following questions. 1. What features distinguish the three types of muscular tissue? 2. List the general functions of muscular tissue. 3.   Describe the four properties of muscular tissue.
the net realizable value of accounts receivable not change when you write off an uncollectible account...
the net realizable value of accounts receivable not change when you write off an uncollectible account using allowance method. Explain in detail.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT