Question

1) You sent off a sample for sequencing in order to aid in prescribing the proper treatment and got the following sequence back:

a. TGGATTATGCGATGTCGGTCATTTTGGACCGGGCTTTGCGCATATCGCAGACGGTTTAAAGCCCGTCCAGCGTCGAATCGTGTACGCCATGTCAGAATTGGGTTTAAAATCAACCGCTAAGTATAAGAAATCAGCGCGGACGGTAGGCGACGTTTTGGGTAAATTCCATCCGCACGGAGACACCGCCTGTTACGAGGCCATGGTATTGATGGCCCAACCTTTTTCATTTCGCTATCCCTTTGTCGATGGGCAAGGCAATTGGGGGAGCGCGGATGATCCC AAATCCTTTGCCGCCATGCGTTATACGGAAGCACGTCTG

b. Describe the complete process, step by step, that this protein plays a role in.

2)Use an online tool to transcribe and translate the sequence and paste below. Describe how that would be done inside the cell of the pathogen in detail.

3)E.coli has a glutamine at position 87 in this protein. Our pathogen has a glycine. Speculate on how this affects the organism and it’s ability to cause/maintain/spread disease in humans. Give molecular detail.

Answer 1

1. Sequencing steps.

• The above sequence is produced as a result of amplification of small amount of sample by PCR.
• The products of the PCR are removed and purified. Primers, excess nucleotides are removed.
• The sample is then prepared for sequencing . The end nucleotide is linked with a fluroscent marker.
• with the help of the fluroscent label , the DNAs are selected.
• The selected sequence is analysed with the known database.

2)

• Online tools like BLAST allows to determine the sequence similarity between the gene of interest and pathogen's genes .
• The gene is inserted into the vector like plasmid and inserted intoi the pathogen.
• The plasmid is allowed to replicate in the cell and the protein produced can be determined.
• The plasmid is incorporated with green fluorescent protein (GFP) and protein is determined by the expression of the GFP.

3.

• Glycine is the smallest aminoacid .
• Glutamine is larger compared to glycine .
• So, glycine conatining protein has different tertiary structure compared to glutamine containing protein.
• This is because glycine is bound deep inside the pocket but glutamine cannot bind like that.
• This causes difference in the tertiary structure and its interaction between other components around the protein.