1) You sent off a sample for sequencing in order to aid in prescribing the proper...

1) You sent off a sample for sequencing in order to aid in prescribing the proper treatment and got the following sequence back:

a. TGGATTATGCGATGTCGGTCATTTTGGACCGGGCTTTGCGCATATCGCAGACGGTTTAAAGCCCGTCCAGCGTCGAATCGTGTACGCCATGTCAGAATTGGGTTTAAAATCAACCGCTAAGTATAAGAAATCAGCGCGGACGGTAGGCGACGTTTTGGGTAAATTCCATCCGCACGGAGACACCGCCTGTTACGAGGCCATGGTATTGATGGCCCAACCTTTTTCATTTCGCTATCCCTTTGTCGATGGGCAAGGCAATTGGGGGAGCGCGGATGATCCC AAATCCTTTGCCGCCATGCGTTATACGGAAGCACGTCTG

b. Describe the complete process, step by step, that this protein plays a role in.

2)Use an online tool to transcribe and translate the sequence and paste below. Describe how that would be done inside the cell of the pathogen in detail.

3)E.coli has a glutamine at position 87 in this protein. Our pathogen has a glycine. Speculate on how this affects the organism and it’s ability to cause/maintain/spread disease in humans. Give molecular detail.

Expert Solution

1. Sequencing steps.

The above sequence is produced as a result of amplification of small amount of sample by PCR.
The products of the PCR are removed and purified. Primers, excess nucleotides are removed.
The sample is then prepared for sequencing . The end nucleotide is linked with a fluroscent marker.
with the help of the fluroscent label , the DNAs are selected.
The selected sequence is analysed with the known database.

2)

Online tools like BLAST allows to determine the sequence similarity between the gene of interest and pathogen's genes .
The gene is inserted into the vector like plasmid and inserted intoi the pathogen.
The plasmid is allowed to replicate in the cell and the protein produced can be determined.
The plasmid is incorporated with green fluorescent protein (GFP) and protein is determined by the expression of the GFP.

3.

Glycine is the smallest aminoacid .
Glutamine is larger compared to glycine .
So, glycine conatining protein has different tertiary structure compared to glutamine containing protein.
This is because glycine is bound deep inside the pocket but glutamine cannot bind like that.
This causes difference in the tertiary structure and its interaction between other components around the protein.

gladiator answered 1 year ago

1. With the aid of a diagram, discuss the effects of off-setting the balance of one...

1. With the aid of a diagram, discuss the effects of off-setting the balance of one of the triple constraints of project management. 2. PMBOK (2013:66) defines the project charter as; “…the document that formally authorizes the existence of a project and provides the project manager with the authority to apply organizational resources to project activities”. Develop a project charter for a project of your choice clearly outlining and discussing its key components. (10 marks

You place an order for 1 box of granola bars off of Amazon, the shipment comes...

You place an order for 1 box of granola bars off of Amazon, the shipment comes and there are 10 boxes of the granola bars. What are your obligations to the items you recieved?

1.) In order for data security systems to be effective, there must be a proper balance...

1.) In order for data security systems to be effective, there must be a proper balance between what an individual is expected to divulge and another factor. What is this second factor? a. what the security system costs and the known or projected benefits b. what level of technology acceptance and user satisfaction is expected c. what the size of the organization is relative to its external environment d. what information employment and management decisions require 2.) Systems thinking views...

Perform the following calculations and round off the answers to proper significant figures: 1. 9.82 ml...

Perform the following calculations and round off the answers to proper significant figures: 1. 9.82 ml + 10.0 ml + 9.980 ml = 2. (62.927 g/ml)(10.0 ml) = Show calculation work

Scenario 1 – Contracts Greg, a consumer in Tennessee, sent a purchase order to Campbell Manufacturing,...

Scenario 1 – Contracts Greg, a consumer in Tennessee, sent a purchase order to Campbell Manufacturing, a U.S. company, for a 4000 PSI gas pressure washer valued at $1275. Greg needed a new pressure washer for his part time business of washing houses. The order did not specify how disputes between the parties would be settled. Campbell returned a definite, unconditional acceptance that contained one additional term which stated that disputes must be submitted to arbitration. Greg received the acceptance;...

Would you be willing to give up any of your civil rights in order to aid...

Would you be willing to give up any of your civil rights in order to aid the war on terror? Explain your response. (Criminology Course)

Question 6 (1 point) The number of text messages sent by a random sample of students...

Question 6 (1 point) The number of text messages sent by a random sample of students at a local university was collected and the following histogram was created: Which of the following statements is likely true: Question 6 options: The distribution of number of text messages sent is approximately symmetric, so the mean is approximately the same as the median. The distribution of number of text messages sent is skewed to the left, so the mean is likely less than...

Question