What can you say about the following three sequences? 1 ) sequence = range [0, 100,...

What can you say about the following three sequences?

1 ) sequence = range [0, 100, 7]

{0, 7 ,14 ,21 ,28 ,35 ,42 ,49 ,56 ,63 ,70 ,77 ,84 ,91 ,98]

2 ) sequence = range [7, 100, 7]

{7, 14, 21, 28, 35, 42, 49, 56, 63, 70, 77, 84, 91, 98}

3 ) sequence = table [ x^2, {x, 0, 17} ]

{0, 1, 4, 9, 16, 25, 36, 49, 64, 81, 100, 121, 144, 169, 196, 225, 256, 289}

___________________________________________________________

A. All three sequences are arithmetic sequences.

B. Only two of the three sequences are arithmetic sequences.

C. All three sequences are geometric sequences.

D. Only two of the three sequences are geometric sequences.

Expert Solution

milcah answered 2 years ago

If the MU of a product is high, what can you say about the following: The...

If the MU of a product is high, what can you say about the following: The shape of the price elasticity of demand for that product. How high will the price likely to go?

what can you say about the economy, culture and religion of FRANCE? can you say something...

what can you say about the economy, culture and religion of FRANCE? can you say something about it? please give an example for each type. thank you so much. needed for my assignment.

In sequences and series what is a sequence and what is a series? Mention some types of sequences?

Find sequences that satisfy the following or explain why no such sequence exists: a) A sequence...

Find sequences that satisfy the following or explain why no such sequence exists: a) A sequence with subsequences converging to 1, 2, and 3. b) A sequence that is bounded above, but has no convergent subsequence. c) A sequence that has a convergent subsequence but is unbounded (note: unbounded means not bounded below or not bounded above. d) A sequence that is monotonic and bounded, but does not converge.

Question 1 - Infinite Sequences. (a). Determine an infinite sequence that satisfies the following . ....

Question 1 - Infinite Sequences. (a). Determine an infinite sequence that satisfies the following . . . (i) An infinite sequence that is bounded below, decreasing, and convergent (ii) An infinite sequence that is bounded above and divergent (iii) An infinite sequence that is monotonic and converges to 1 as n → ∞ (iv) An infinite sequence that is neither increasing nor decreasing and converges to 0 as n → ∞ (b). Given the recurrence relation an = an−1 +...

6. The following sequences are mutations of the template sequence in question 1. For each mutated...

6. The following sequences are mutations of the template sequence in question 1. For each mutated sequence, indicate the new amino acid sequence produced and the type of mutation that is the end result in the amino acid (frameshift, Missense, nonsense, silent) as well as the type of mutation that occurred in the DNA sequence (substitution, addition, deletion) Template sequence question 1: 3’ TACCCTGGTGGTTTGCGGACT 5’ a. 3’ TAC CCG GTG GTT TGC GGACT 5’ b. 3’ TAC ACT GGTGGTTTGCGGACT 5’...

Question 1 If "P v Q" is false, then what can you say about the truth...

Question 1 If "P v Q" is false, then what can you say about the truth value of P? A.P is true B.P is false. C.P can be true or false. Question 2 If ( P v Q ) is true, then what can you say about the truth value of P A.P is true. B.P can be true or false. Question 3 If ( P · Q ) is false, then what can you say about the truth value...

1. A distribution that is skewed right has mean 150. What can you say about the...

1. A distribution that is skewed right has mean 150. What can you say about the value of its median? 2. A sample of 7 numbers has mean 142 and standard deviation s = 0. What can you say about the values of the numbers? Be precise!

What is the mRNA sequence of the following original DNA sequences? a) TAC b) GAG c)...

What is the mRNA sequence of the following original DNA sequences? a) TAC b) GAG c) CAT d) AAA e) GCC f) TTC g) CCG h) TGT

1. On a standard expected return versus standard deviation graph, what can you say about the...

1. On a standard expected return versus standard deviation graph, what can you say about the desired sharpe ratio? (Points : 3.33) want the ratio to be as high as possible want the ratio to be as low as possible want the return to be as high as possible want the risk to be as low as possible want the downside risk to be as low as possible 2. A portfolio is composed of two stocks, A and B. Stock...

Question