Question

In: Biology

advantages of using a protien sequence rather than a DNA sequence when searching the bioinformatics database

advantages of using a protien sequence rather than a DNA sequence when searching the bioinformatics database

Solutions

Expert Solution

There are many reasons of why searching a protein sequence is more logical than searching for a DNA sequence in a database. For starters, consider this: DNA is made up of genes, and these genes code for a certain protein. Now there are many different genes that code for the same protein, and most of the times, we miss to check all genes that are there, so it leads to a sort of insignificant study. The second reason is that, it is not always characterized in the gene sequence that what part of gene would actually be functional and what part would be cleaved later on. In that case it is beneficial to study a protein sequence. Other major reason is that DNA is just made of 4 bases, that are, A,T,G and C; because of which whenever you're looking for similarity of a gene sequnece to others, they'll be atleast 25% similar, which is something misleading. Whereas if you look at a protein sequence, there are atleast 20 different amino acids, and so when you look similarity of a protein sequence with others, the results will be quiet satisfying. Also, if you look at any database for DNA sequences, you'll always find them large, and more are the chances of the data to be random and sometimes error prone. It is a huge task to negate all irrelevant sequences for a stretch of DNA. Contrastingly, the databases used for protein sequencing are more easier to study. A major factor about DNA that misleads in reasearch is its ability of the DNA to get mutated, if a mutation causes change in a protein, then it is relevant to study that mutation. But there's a fact that sometimes error in DNA leads to no protein change but it would still be different from other sequences, while protein sequences usually remain conserved, so its quite easier to study them. When you're looking for DNA sequences, generally identity matrices are used, and they're not that much senitive; while, for protein sequences PAM and BLOSUM matrices are used, and they're very sensitive.


Related Solutions

What are the advantages of a using a linked list rather than a conventional array in...
What are the advantages of a using a linked list rather than a conventional array in Java? and when would it be more efficient to use an array rather than a linked list? Explain your answer.
(1) What are the advantages and disadvantages to using the int data type rather than the...
(1) What are the advantages and disadvantages to using the int data type rather than the bool data type to manipulate Boolean expressions? Why do students think the int data type is still used for Boolean expressions? (2) Discuss how C++ provides two-way selection through the if…else statement. Explain the syntax of this statement. Also, explain how the bool data type is used in C++ to manipulate Boolean expressions.
What are the advantages and disadvantages of using ranks rather than continuous measurements to conduct tests...
What are the advantages and disadvantages of using ranks rather than continuous measurements to conduct tests of hypotheses?
What are some advantages and challenges of using a logic-driven analytics process rather than follow a...
What are some advantages and challenges of using a logic-driven analytics process rather than follow a data-driven analytics process??
What are the advantages if breathing through the nose rather than the mouth?
What are the advantages if breathing through the nose rather than the mouth?
What are the advantages of targeting candy bars to adults rather than to children?
What are the advantages of targeting candy bars to adults rather than to children?
In financial terms, what is the biggest downfall to using payback rather than discounted payback when...
In financial terms, what is the biggest downfall to using payback rather than discounted payback when analyzing a project? The first choice always seems to be best. It does not account for time value of money. The WACC isn't accurate. It is more difficult to calculate than discounted payback.
1. What are the advantages and disadvantages of investing with an investment company rather than buying...
1. What are the advantages and disadvantages of investing with an investment company rather than buying securities directly?
Using a DNA sequence as an example, illustrate and describe the listed mutations - deletion -...
Using a DNA sequence as an example, illustrate and describe the listed mutations - deletion - insertion - nonsense mutation - substitution - back mutation
Using the following DNA sequence, come up with your own corresponding sequence after a 1) point...
Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation. Also write out the corresponding RNA sequence: AGTAAACGTACCTGAGACGGG Explain how gene regulation in eukaryotes differs from gene regulation in prokaryotes.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT