Question

In: Computer Science

Visualize the initially empty myHeap after the following sequence of operations o myHeap.add(2) o myHeap.add(3) o...

Visualize the initially empty myHeap after the following sequence of operations
o myHeap.add(2)
o myHeap.add(3)
o myHeap.add(4)
o myHeap.add(1)
o myHeap.add(9)
o myHeap.remove()
o myHeap.add(7)
o myHeap.add(6)
o myHeap.remove()
o myHeap.add(5)

Solutions

Expert Solution

what I understood in question solved accordingly both max heap and min heap

anything doubtful or not understand just comment I will touch with you

please upvote for my effort

thank you and all the best


Related Solutions

Integration question: Fluid flows into a tank for 10 minutes. The tank is initially empty. After...
Integration question: Fluid flows into a tank for 10 minutes. The tank is initially empty. After t minutes, fluid flows in at a rate of 1 + t/2 litres per minute. How much fluid, in litres, flows into the tank?
Insert the following values into an initially empty B+ tree with parameter d=3    17, 11, 50,...
Insert the following values into an initially empty B+ tree with parameter d=3    17, 11, 50, 22, 5, 35, 42, 60, 15, 30, 25, 27, 37, 40, 20.
Insert the following values into an initially empty B+ tree with parameter d=2 17, 11, 50,...
Insert the following values into an initially empty B+ tree with parameter d=2 17, 11, 50, 22, 5, 35, 42, 60, 15, 30, 25, 27, 37, 40, 20.
Suppose an initially empty stack S has performed a total of 15 push operations, 12 top...
Suppose an initially empty stack S has performed a total of 15 push operations, 12 top operations, and 13 pop operations ( 3 of which returned null to indicate an empty stack ). What is the current size of S? Question 1 options: Question 2 (1 point) Saved What values are returned during the following series of stack operations, if executed upon an initially empty stack? push(5), push(3), pop(), push(2), push(8), pop(), pop(), push(9), push(1), pop(), push(7), push(6), pop(), pop(),...
Suppose you start with an empty queue and perform the following operations: enqueue 1, enqueue 2,...
Suppose you start with an empty queue and perform the following operations: enqueue 1, enqueue 2, dequeue, enqueue 3, enqueue 4, dequeue, enqueue 5. What are the resultant contents of the queue, from front to back? Group of answer choices 1, 2, 3, 4, 5 1, 3, 5 1, 2, 3 3, 4, 5 Assume you are using the text's array-based queue and have just instantiated a queue of capacity 10. You enqueue 5 elements, dequeue 4 elements, and then...
Provide an example 1) A nested sequence of closed, nonempty sets whose intersection is empty. 2)...
Provide an example 1) A nested sequence of closed, nonempty sets whose intersection is empty. 2) A set A that is not compact and an open set B such that A ∪ B is compact. 3) A set A that is not open, but removing one point from A produces an open set. 4) A set with infinitely many boundary points. 5) A closed set with exactly one boundary point
Give O(n) sequence of Fibonacci-heap operations, which creates a Fibonacciheap which has more number of marked...
Give O(n) sequence of Fibonacci-heap operations, which creates a Fibonacciheap which has more number of marked nodes than the number of nodes that are not marked.
Answer the following question: o After looking into Hofstede reading in week 2 “cultural perspectives”, Consider...
Answer the following question: o After looking into Hofstede reading in week 2 “cultural perspectives”, Consider Oman mixed culture and differentiate the advantage and disadvantages of these dimension and their effect on innovation and entrepreneurship
A single product (A) moves in sequence through 3 operations: V, W, and X. The processing...
A single product (A) moves in sequence through 3 operations: V, W, and X. The processing time at each operation (in minutes per unit) is 10, 20 and 10 respectively. If the process batch size and the transfer batch size are both 100, what is the total amount of time required to process the batch? If the transfer batch size is reduced to 50, now how much total time will be required to complete the batch (do not worry about...
Using the following DNA sequence, come up with your own corresponding sequence after a 1) point...
Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation. Also write out the corresponding RNA sequence: AGTAAACGTACCTGAGACGGG Explain how gene regulation in eukaryotes differs from gene regulation in prokaryotes.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT