Question

In: Biology

Place the steps in their proper order on the figure to complete the summary of gene expression in a eukaryotic cell.

Place the steps in their proper order on the figure to complete the summary of gene expression in a eukaryotic cell.Place the steps in their proper order on the figure to complete the summary of gene expression in a eukaryotic cell. Place your cursor on the boxes for h nts. At termination, the ribosome Polypeptide synthesis takes Anticodon-Codon DNA in nucleus serves as a detaches from the ER, ribosomal place one amino acid at a complementary base template subunits and the mRNA. pairing occurs. time. dissociate When a ribosome attaches to tRNAs with anticodons mRNA moves into Pre-mRNA is processed rough ER, the polypeptide enters carry amino acids to cytoplasm and becomes its lumen, where the polypeptide before leaving the nucleus. mRNA associated with ribosomes. folds and is modified further.


Solutions

Expert Solution

According to the theory of central dogma, mRNA is synthesized by transcription of the coding sequence of DNA in the nucleus. As the nascent mRNA moves out of nucleus, it reaches the rough endoplasmic reticulus and hence the ribosomes. Here, the closely coupled activity of the tRNA, codon complementarity and initiation of the translation play a critical role in synthesis of appropriate amino acids from the mRNA. The whole process is regulated at very steps and is of very high accuray and fidelity.

Thus, the correct order of events can be summarized as below:

  1. DNA in nucleus serves as template.
  2. Pre-mRNA is processed before leaving from nucleus.
  3. mRNA moves from nucleus reaches the cytoplasm and gets associated with ribosomes.
  4. tRNA with anticodons carry amino acids on mRNA.
  5. Codon-anticodon base pair complementarity takes place
  6. Polypeptide synthesis takes place at one amino acid at a time.
  7. When ribosome attaches the ER, the polypeptide enters the lumen where polypeptide folds and undergoes further modifications.
  8. At termination, the ribosome detaches from ER and ribosomal subunits and mRNA dissociate.

Thus, the above given order of events describe the process of transcription, translation and post-translational modifications.


Related Solutions

Place the steps in their proper order on the figure to complete the summary of gene expression in a eukaryotic cell, Place your cursor on the boxes for hints.
Place the steps in their proper order on the figure to complete the summary of gene expression in a eukaryotic cell, Place your cursor on the boxes for hints. 
Describe, in detail, 3 ways that a eukaryotic cell regulates gene expression.
Describe, in detail, 3 ways that a eukaryotic cell regulates gene expression.
Explain the regulation of gene expression in eukaryotic cells. Discuss mechanisms by which gene expression may...
Explain the regulation of gene expression in eukaryotic cells. Discuss mechanisms by which gene expression may be altered. How do these alterations induce cancer-causing mutations in cell DNA? Explain how cancer is formed. Describe genetic changes found in cancer cells and how these changes lead to alterations in cell behavior. Determine whether proteome data can be utilized in genetic disorder diagnosis. Relate the Human Genome Project data to the analysis of cancer genes.
How does gene expression initiate? What are the key steps in gene expression?
How does gene expression initiate? What are the key steps in gene expression?
Understand the steps of the eukaryotic cell cycle.
Understand the steps of the eukaryotic cell cycle.
1. Eukaryotic transcription factors control gene expression in a combinatorial manner. a) With the aid of...
1. Eukaryotic transcription factors control gene expression in a combinatorial manner. a) With the aid of a diagram, briefly discuss this statement. b) Provide an example of how combinatorial regulation of gene expression is involved in the development of higher organisms.
Which of the following is a difference between prokaryotic and eukaryotic gene expression Group of answer...
Which of the following is a difference between prokaryotic and eukaryotic gene expression Group of answer choices 1)Eukaryotes have basal transcription factors not part of the holoenzyme 2)Eukaryotes produce an immature mRNA 3)Trancription and translation can occur simultaneously in Prok. 4)Eukaryotics have more diverse promoters 5)All of the above
Compare and contrast the gene expression regulation mechanisms of prokaryotic and eukaryotic organisms. (essay)
Compare and contrast the gene expression regulation mechanisms of prokaryotic and eukaryotic organisms. (essay)
The overall process of prokaryotic and eukaryotic gene expression are very similar, employing the same basic...
The overall process of prokaryotic and eukaryotic gene expression are very similar, employing the same basic mechanisms of transcription initiation, elongation, and termination by RNA polymerase followed by translation of the mRNA by ribosomes and charges tRNAs. The eukaryotic process, however, has a few unique aspects to I. List or describe some of these important differences.
Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the...
Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the boxed G/C base pair and proceeds from left to right. 5’-CCGATAAATGGCCGATTACGATATGCCAGATCATTACAACTAACGAGGCC -3’ 1 - - - - - - - - - - +- - - - - - - - - - -+- - - - - - - - - - +- - - - - - - - -+ - - - - - - - - - - - -+...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT