Question

In: Nursing

Preop Diagnosis: Foreign body on the left little finger at the metacarpal phalangeal joint (broken piece...

Preop Diagnosis: Foreign body on the left little finger at the metacarpal phalangeal joint (broken piece of glass)

Postop Diagnosis: Same

Operation: Exploration of the MP joint of the left little finger with excision and removal of foreign body (broken pieces of glass)

Indication of Surgery: On June 9, the patient was involved in a motor vehicle accident. She was a passenger and somehow their automobile hit a pedestrian and the

pedestrian’s body flew up and hit the windshield, breaking the windshield. She tried to brace herself with her left hand and sustained a laceration on the dorsum of the

metacarpal phalangeal joint of the left little finger. At that time she did not think anything of it. She did not even see a physician. The wound subsequently healed, but she

stated (started) noticing some pain in that region. On August 19, she accidentally hit the metacarpal phalangeal joint of the left little finger against something and since then she

has been complaining of severe pain and numbness. She had an x-ray of her left hand which revealed a foreign body in the metacarpal phalangeal joint of the left little finger.

The patient was referred to me. I explained to the patient I need to open up the wound, explore the area, and remove the foreign body. The possible risks, benefits, and

possible complication of the procedure were explained.

Technique: The patient was placed on the OR bed, assuming the supine position. Blood pressure monitoring and pulse oximetry monitoring were in progress. The left

hand and forearm were prepped and draped. Initially, I tried to palpate the metacarpal phalangeal joint until I found the areas that is the most tender. This area is located at

the dorsum of the MP joint of the left little finger proximal to the previously healed scar. This area was then marked out and infiltrated with 1 percent Carbocaine solution. An

oblique incision was then made over the area parallel to the old scar. Incision was deepened and bleeders were fulgurated with high temperature. By careful sharp and

blunt dissection, the foreign body was searched for. For a while, I could not find the foreign body. Therefore, the incision was extended distally towards the previous area of

the laceration. After searching for some time, it was found that the dorsal digital nerve in this area was intact. It was retracted out of harm’s way and the area near the

extensor tendon toward the foot of the extensor tendon. The foreign body was wedged underneath the foot of the tendon in the joint space. It was a piece of broken glass and

measures about 2 x 3 x 1 mm. It was completely extracted and removed. The wound was irrigated with a large amount of saline solution. Wound closure was accomplished

with 5-0 nylon interrupted mattress sutures. Compression dressing was applied. The patient withstood the procedure well.

What is the final ICD-10-PCS code assigned?

One code only!

Additional information: The intention is to remove foreign body which is evidenced by information in preoperative diagnosis line and under “Indication of surgery”. The time to

find the foreign body is not separately coded. The wound closure at end of procedure is not separately coded. The surgical approach is noted by documentation as “An oblique

incision was then made...By careful sharp and blunt dissection...dorsal digital nerve was retracted...” all of this points to more than percutaneous. The physician used a

scalpel to make the cut or the incision. After finding it the foreign body, though small was removed.

Solutions

Expert Solution

0 Medical and Surgicals

                   R Joint

                     C Extripation

                        V Metacarpophangeal left  

                           0 Open appoach

                               Z No device

                                  Z No equalifier

                               

Approach

Device

Qualifier

0 - Open

Z - No device

Z - No qualifier

3 - Percutaneous             

4 - Percutaneous Endoscopic

The is cd-10 procedure code is 0RCV[034]ZZ


Related Solutions

the most frequently broken bone in the body is the what is the most frequent broken...
the most frequently broken bone in the body is the what is the most frequent broken bone in the body?
pick one of the following locations: The right pinky finger The mesentery The left breast The...
pick one of the following locations: The right pinky finger The mesentery The left breast The posterior left knee Describe the formation of lymph within that region, relating that to blood vessels within the region and addressing the physical forces that lead to lymph production. How would the lymph that is formed in that region be returned to the blood supply? What vessels and lymph organs would it travel through? Also, imagine that there is a potential pathogen within your...
Trace the path of a drop of blood from the left atrium to right index finger?
Trace the path of a drop of blood from the left atrium to right index finger?
A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced....
A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced. The sequence of each fragment is shown below. Fragment 1: 5'-TAGTTAAAAC-3' Fragment 2: 5' - ACCGCAATACCCTAGTTAAA-3' Fragment 3: 5' - CCCTAGTTAAAAC-3' Fragment 4: 5' - ACCGCAATACCCTAGTT - 3' Fragment 5: 5' - ACCGCAATACCCTAGTTAAA - 3' Fragment 6: 5' - ATTTACCGCAAT - 3' On the basis of overlap in sequence, create a contig sequence of the original piece of DNA
Sonographic differential diagnosis of a male with painful left submandibullar swelling
Sonographic differential diagnosis of a male with painful left submandibullar swelling
Procedure A: A piece of fresh liver and little bit of water was put inside of...
Procedure A: A piece of fresh liver and little bit of water was put inside of test tube. The test tube was put inside of boiling water for five minutes. Test tube was taken out from boiling water and drained out the water. 2 mL of hydrogen peroxide was put inside of the test tube and only little bubbles (enzyme activity ) were formed. Q1. What was the purpose of the assay performed? Q2. Did increasing the temperature (heating the...
A paper edge slices your left index finger and you immediately move your hand away but...
A paper edge slices your left index finger and you immediately move your hand away but it takes a few moments before you are “aware” of the pain. Then, by lightly rubbing the area, the pain disappears. A. Name and diagram the reflex pathwaythat allowed you to remove your hand. B. Why was the “feeling of pain” delayed? Where would this information ultimately have been interpreted? Name the fiber type associated with the primary afferent involved, and name the somatosensensory...
Carbohydrates are the main sources of fuel for the body. They’re broken down into glucose, which...
Carbohydrates are the main sources of fuel for the body. They’re broken down into glucose, which is “burned” as fuel for the body. i. What is expected to occur when the body’s supply of glucose runs out? ii. Would insulin or glucagon be of any importance in this regard? Explain your answer. iii. As a nurse on duty, a patient is brought to the emergency ward with symptoms of weakness, dizziness, headache and slight disorientation. The patient has a history...
What is the osteology and muscle action for each joint in the body?
What is the osteology and muscle action for each joint in the body?
What are designs/devices being used today for finger joint replacements (MCP) *include about 3 or more...
What are designs/devices being used today for finger joint replacements (MCP) *include about 3 or more devices* 1. Description of each device (mechanics involved) 2.FDA class 3. Which current design is the most used today Please include citations from the information obtained Thank you
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT