Question

In: Physics

A molecule of DNA (deoxyribonucleic acid) is 2.31

A molecule of DNA (deoxyribonucleic acid) is 2.31

Solutions

Expert Solution

  Since one end of the DNA is negatively charged by a single electron, and the other end is positively charged, then the two ends attract each other.

You know the distance between the two charges, so you can compute the attractive force between them.

Also DNA acts like a spring that opposes being compressed.

Once the DNA is compressed to .96% of its original length, the the electrical force of attraction between the ends must be equal to the opposing spring force of the DNA.

Use the formula for computing the attractive electrical force:

F_e = (K * q1 * q2 ) / (d^2) using the distance d=(.0096)*(.00000231 m )

=2.2e-8m

(remember that this must be in meters)

And use the spring equation: F_s = k * x , where k is the spring constant, and x is the amount of compression from equilibrium:

x=(original length) -(final length)
x = (0.00000231 m ) - ( .0096 )*( 0.00000231 m )

x= 231e-8 -2.2e-8m

x=228.8e-8m

Set the two force equations equal to each other , and solve for k

(K * q1 * q2 ) / (d^2)=k * x

9*10^8/(2.2e-8m)^2=k*228.8e-8m

1.8e24/228.8e-8m=k

0.00812e32=k


Related Solutions

A molecule of DNA (deoxyribonucleic acid) lies along a straight line. It is 1.472
A molecule of DNA (deoxyribonucleic acid) lies along a straight line. It is 1.472
Lab Exercise 10 - ISOLATION OF DNA FROM PLANTS Introduction Deoxyribonucleic acid (DNA) is located in...
Lab Exercise 10 - ISOLATION OF DNA FROM PLANTS Introduction Deoxyribonucleic acid (DNA) is located in the nucleus of eukaryotic cells (animals, plants, fungi, and protists). DNA contains information to direct the cell in the manufacture of proteins. Proteins control development, organ function, metabolism, enzymatic reactions, photosynthesis, muscle action, brain activity, and many other cellular processes. DNA is often referred to as the “blueprint for life”. DNA is a polymer composed of the nucleotide bases guanine (G), adenine (A), thymine...
“Genes” are composed of a substance called: A. Deoxyribonucleic Acid (DNA) B. Carbohydrate C. Protein D....
“Genes” are composed of a substance called: A. Deoxyribonucleic Acid (DNA) B. Carbohydrate C. Protein D. Lipid E. None of the above is correct. Hyperglycemia is defined as: A. high plasma sodium B. low plasma sodium C. low plasma glucose D. high plasma glucose E. None of the above is correct. Which of following statements is true? A. Polar molecules cannot cross (by simple diffusion) the cell membrane. B. Non-polar molecules can cross (by simple diffusion) the cell membrane. C....
*******IN PSEUDOCODE AND C++******* Program 0 (Warm-up, 40 pts): Deoxyribonucleic acid, or DNA, is comprised of...
*******IN PSEUDOCODE AND C++******* Program 0 (Warm-up, 40 pts): Deoxyribonucleic acid, or DNA, is comprised of four bases: (G)uanine, (C)ytosine, (A)denine and (T)hymine. Ribonucleic acid, or RNA, is different than DNA in that it contains no Thymine; thymine is replaced with something called (U)racil. For this assignment, you will create an array of 255 characters. You must start by filling the array with random characters of G, C, A and T.   You must then print out the array. Next, replace...
Diagram (draw) and describe the process of DNA replication. Include original molecule, the DNA molecule unzipping,...
Diagram (draw) and describe the process of DNA replication. Include original molecule, the DNA molecule unzipping, the addition of new nucleotides, and the products of replication.  
Why are DNA proofreading enzymes necessary? A DNA molecule can be thought of as having 2...
Why are DNA proofreading enzymes necessary? A DNA molecule can be thought of as having 2 components, corresponding to the sides and rungs of a ladder. What are these 2 components? What class of molecule is telomerase? What does telomerase do? In which human cells is telomerase appropriately active? In what kinds of cells is telomerase inappropriately active?
What features of DNA replication cause each new DNA molecule to be exactly like the original?...
What features of DNA replication cause each new DNA molecule to be exactly like the original? (1pt)      C. Why is replication an important cell process? (1pt)      Point Mutation A. How does the point mutation that you made change the DNA code on your molecule? (2pts) B. Referring to your textbook, explain how mutations can occur in cells and how such changes might affect an organism with the mutation. (2pts)
Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA...
Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA replication: ATCGGCTAGCTACGGCTATTTACGGCATAT TAGCCGATCGATGCCGATAAATGCCGTATA
how does an RNA molecule transcribe DNA molecule: TACCCAATC. what kind of info does this messanger...
how does an RNA molecule transcribe DNA molecule: TACCCAATC. what kind of info does this messanger DNA tell us?
a. Label and give the name for the the major functional groups in the DNA molecule?...
a. Label and give the name for the the major functional groups in the DNA molecule? b. Functional groups are sites where chemical reactions take place. Using your knowledge of basic organic reactions, think about some possible reactions (e.g. SN2, E1, E2, SN1, etc.) that can occur at each of the functional groups in the DNA molecule? c. Label the functional groups in the DNA molecule as hydrophobic or hydrophilic? Is the overall DNA molecule generally classified as hydrophobic or...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT