Find an organization that can analyze your DNA and generate reports on your health risks and...

Find an organization that can analyze your DNA and generate reports on your health risks and ancestry. Would you use this service? Why or why not?

Expert Solution

Organization that can analyze your DNA and generate reports on your health risks and ancestry:
In year 1990, THE INSTITUTES OF HEALTH (NIH) and the department of energy joined with international partners in a quest to sequence all 3 billion letters ,or base pairs ,in the human genome ,which is the complete set of DNA (Deoxyribonucleic acid) a chemical compound that contains genetic instructions for building,running and maintaining living organism in the human body
Human Genome project started as an international project led by Francis Collins in 1990.
Private company called CELERA started mapping the human genome led by Craig Venter. in 1998.
First Draft for the human genome project was released to the public by both organisations in 2001.
HGP (HUMAN GENOME PROJECT) was an international scientific research project with the goal of determining the sequence of nucleotide pair that make up human DNA .
Human DNA sequence determines its uniqueness and it is different in all humans at least at some places.
HGP is called a mega project.
This project is coordinated by U.S department of energy and National institute of health , Welcome trust (UK) become major partner , japan , France ,Germany also helped
Analysis of DNA also help to diagnose ,treat cure and prevent some diseases.
GOALS OF HGP
Identify 20000-250000 genes in human DNA.
Sequence of 3 billion human base pairs.
improve tools for data analysis .
transfer related technologies to industries .
Ethical , social and legal issues should be managed.
yes i would definitely use this service, because it is good to analyse disease before it occur diseases like diabetes can be analyses by this organization. so i think i shall use this service:

The fragments are cloned in bacteria , which store and replicate the human DNA so that it can be prepared in quantities large sequencing so that why we can use this project for disease detection .

Rahul Sunny answered 2 years ago

PCR can generate over 100 _______________ copies of DNA in hours. , _, _, and ___...

PCR can generate over 100 _________________ copies of DNA in hours. ____, _____, _____, and _____ are the nucleotides needed to ______ copies of DNA Why do we need to add primers? What can DNA Polymerase withstand that other enzymes cannot? When do your desired fragments start to appear? On cycle ________________, you have over a billion copies of DNA. What is the purpose of the agarose gel? What makes the DNA move? DNA migrates to the _________________ end of...

21. As a , you work within an organization, prepare reports, and analyze financial information such...

21. As a , you work within an organization, prepare reports, and analyze financial information such as budgets and cost management for internal use only. a. public accountant b. government accountant c. management accountant d. forensic accountant 22. Cressey identifies three types of "offenders". These include all of the following EXCEPT: a. Absconders b. Independent businessmen c. Long-term violators d. Stakeholders 23. In a white collar crime situation, ___________ is created by strong internal controls, good management oversight, and/or through...

Discuss the different types of financial and non-financial risks which pertain to your organization (you can...

Discuss the different types of financial and non-financial risks which pertain to your organization (you can also consider any company ). Consider your organisation or the company related to your group industry project, recommend a capital investment project and discuss what value will it add to the firm and should the organisation take up the project or not? (Hint: Use capital budgeting).

PCR can be utilized to generate a large quantity of a specific DNA fragment. The following...

PCR can be utilized to generate a large quantity of a specific DNA fragment. The following questions refer to a PCR reaction designed to amplify the DNA helix below. Region 1 Region 2 5’ GCTAGCTGTGGCTTAATATAGCCCGCAGTAGCGT 3’ b. While mixing up the PCR reaction mix, you accidentally add too little of the concentrated buffer, thus producing a lower than anticipated ion concentration. To compensate, you should (INCREASE/DECREASE/NOT ALTER) the denaturation temperature. Which of the explanations below best supports your answer? A....

Analyze how Texas Health Harris Methodist Cleburne is a learning organization.

Find financial statements for a health organization to conduct research on

5. A health care organization that discovered weaknesses in the organization’s ability to collect and analyze...

5. A health care organization that discovered weaknesses in the organization’s ability to collect and analyze information and implemented a $50 million information system upgrade. This is an example of a _____ change. a. system b. process c. strategic d. cyclic 6. The recent merger and subsequent divestiture between Dow Chemical and DuPont is an example of a _____ change. a. system b. process c. strategic d. cyclic 7. Which of the...

Assume that you are given the responsibility to assess the risks that confront your organization (where...

Assume that you are given the responsibility to assess the risks that confront your organization (where you currently work, if you are not working, the university is your organization) in the next 12 months. Identify the risk factors that are specific to your organization and discuss their potential impacts.

i Choose amazon organization and analyze it accordingly. Attempt all Questions related to your organization. (Note:...

i Choose amazon organization and analyze it accordingly. Attempt all Questions related to your organization. (Note: Questions should be in the serial order with references wherever is required. C. Market tools and Application( MA ) a) Core Marketing Concepts and define value chain b) Use of Branding and video marketing c) E mail Marketing and Social Media Marketing d) Available tools of E Commerce

i Choose amazon business organization and analyze it accordingly. Attempt all Questions related to your organization....

i Choose amazon business organization and analyze it accordingly. Attempt all Questions related to your organization. (Note: Questions should be in the serial order with references wherever is required. B. Market and Cost Analysis (MA) a) Segmentation analysis and strategy. b) Positioning in the marketplace. c) Procurement of goods and Services d) Major customer acquisition techniques, online advertising, ad serving and targeting

Question