Question

In: Economics

Answer the following questions based on the Video: We the Economy: “Amazing Animated Film on the...

Answer the following questions based on the Video: We the Economy: “Amazing Animated Film on the Debt and the Deficit and “The Fiscal Ship” computer game.

1) List your main three goals in “The Fiscal Ship”.

2) For each of your goals, list two policies you used to achieve these goals. Explain how your goals and policies affected the government budget and the debt.  

Remember that your choices have real life ramifications. Please do not enact policies and create a country that you are not willing to live in just to balance the budget. We all have to live here.

Solutions

Expert Solution

1) Fiscal ship game challenges us to put the federal budget on a sustainable course

The three aims

1.Reduce inequality

2.Invest in the future

3 Fight climate change

3) Policies adopted for achieving the three goals are as follows

*Policies to reduce inequality

1.Boost low wage workers security

2.increse infrastructure spending

3.Increse tax on capital gains and dividends

4.Expand earned income tax credit

Although the measures like first two will result in increased government expenditure.lt will be almost balanced by the increase in revenue via taxes

*) Policies to invest in the future

1.More loans for students and simplification of the terms and conditions for that.

2 Benefits for the educated young population to get training.

3.increse the budgets of National Science foundation and NASA and National institutes of health

4.Provide new scholarships for researchers.

The incresed spending on NASA and National science foundation won't hurt budgets much because budgets of these agencies represent less than 1.5 percent of federal outlay.How ever the policies for students will be expensive

* ) Policies to fight climate change

1 imposition of carbon tax

2.Provide incentives for the production of electric vehicles

3.Tax reductions for companies that invest in conserving the environment.

4.Promotion of research in the field of renewable energy generation as well as environmental protection.

Even though implementing carbon tax will be problematic it will raise government revenue as well as protect the environment.Research funding though expensive will have positive long run impact.


Related Solutions

Answer 3 of the of these 5 questions AND the questions related to the video in...
Answer 3 of the of these 5 questions AND the questions related to the video in folder on Middle-age: Describe the physical changes that occur during middle age – brain, muscles, senses, skeletal, etc., How do these changes affect daily life and health? Explain the terms “fluid” and “crystallized” intelligence, “”, “menopause” “empty nest syndrome” Describe Erickson’s stage of developmental crisis for middle adulthood. Generativity vs. Stagnation Explain the terms - mid-life crisis, empty nest syndrome, cluttered nest, How do...
Answer these questions based on the CGP Grey Video, “Humans Need Not Apply” Grey describes automation...
Answer these questions based on the CGP Grey Video, “Humans Need Not Apply” Grey describes automation as a significant threat to the workforce. Is this view accurate? Refer to specific ideas from the video in your answer and explanation. How must society change, if at all, to accommodate technological advancements that will affect the labor force? What can you do personally to ensure your own employability in a technologically evolving civilization?
Question (1) Answer each of the following questions briefly. These questions are based on the following...
Question (1) Answer each of the following questions briefly. These questions are based on the following relational schema: Emp(eid: integer, ename: string, age: integer, salary: real) Works(eid: integer, did: integer, pcttime: integer) Dept(did: integer, dname: string, budget: real, managerid: integer) (a) (5 points) Give an example of a foreign key constraint that involves the Dept relation. What are the options for enforcing this constraint when a user attempts to delete a Dept tuple? (b) (5 points) Write the SQL statements...
Sustaining with Purpose What drives you to innovate? based on video documentary fuji film company
Sustaining with Purpose What drives you to innovate? based on video documentary fuji film company
Scaling success :How you scale successfully ? based video documentary fuji film company
Scaling success :How you scale successfully ? based video documentary fuji film company
Answer the following unrelated short-answer questions. a. An economist makes the following argument – “The economy...
Answer the following unrelated short-answer questions. a. An economist makes the following argument – “The economy basically self-corrects out of recessions. When the economy is in recession, unemployment creates an excess supply of labor, which causes wages to fall. As a result, employers increase their hiring and the economy recovers automatically.” How would a Keynesian respond to this claim? b. Consider an economy where the reserve ratio is ? = 0.2 and the currency ratio is ? = 0.2. What...
Answer True or False for all questions: 1. A society that relies on a market-based economy...
Answer True or False for all questions: 1. A society that relies on a market-based economy will always protect the natural environment. 2. With the technological developments in the twenty-first century, productivity growth is no longer an important factor in economic well-being. 3. The minimum wage is an example of a government price ceiling and results in a reduction in unemployment. 4. Efficient production can be carried out anywhere on or beyond the production possibilities frontier. 5. An economist would...
Answer the following questions based on this codingstrand of DNA:                               &nbs
Answer the following questions based on this codingstrand of DNA:                                                                         5’ GGCCATGACAGAGGAGCAAAAGTTATTGCT 3’ Drennan et al. (1996) identified several mutations in this enzyme that result in methylmalonic acidemia (MMA). One of those mutations is a C to A at base pair 1904 in the coding strand of DNA (bold and italicized in the template strand). Write the unique coding strand of DNA for this patient and highlight the change you made. Write it 5’ to 3’. Write the mRNA sequence...
(video transcription needed for questions) >> No, definitely. If we had -- if when we started...
(video transcription needed for questions) >> No, definitely. If we had -- if when we started if we had many employees that were full-time, we definitely would not be the same today, or even possibly here. Name is Ryan Grey Smith, founder of Modern-Shed. I mean, kind of imagine, if you need to do a business organization and you want to bring it all in-house, you have to have the accounting position, you have to have the organizing position, the...
Watch the video on Icelandic fishing and answer the following questions: Explain the public good identified...
Watch the video on Icelandic fishing and answer the following questions: Explain the public good identified in the video? Explain the two characteristics of this good that make it "public". Explain the externality that results from over-fishing? Who is impacted? How are they impacted from overfishing? How did they solve this problem? Use the information from the video to answer this question. Why is this considered better than taxing/subsidizing (which is the solution discussed in your text)? https://www.youtube.com/watch?v=sCLd8T1HNN8&feature=emb_title
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT