IV. More practice with momentum and collisions A. A skater of mass 45.0 kg standing on ice throws a stone of mass 7.65 kg with a speed of 20.9 m/s in a horizontal direction. Find: 1. The speed of the skater after throwing the stone. 2. The distance over which the skater will move in the opposite direction if the coefficient of kinetic friction between his skates and the ice is 0.03. Include an energy bar chart in your solution. B. A tall man walking at 1.25 m/s accidentally bumps his head of mass 2.95 kg on a steel doorframe. His head stops in 0.011 s. 1. What is the magnitude of the average force exerted by the doorframe on the man's head? 2. Explain why putting padding on the doorframe would help reduce this force.

Thermal Rising, Inc., makes paragliders for sale through specialty sporting goods stores. The company has a standard paraglider model, but also makes custom-designed paragliders. Management has designed an activity-based costing system with the following activity cost pools and activity rates:

Management would like an analysis of the profitability of a particular customer, Big Sky Outfitters, which has ordered the following products over the last 12 months:

The company’s direct labor rate is $18 per hour.

Required:

Using the company’s activity-based costing system, compute the customer margin of Big Sky Outfitters. (Round your intermediate calculations and final answer to the nearest whole dollar amount. Loss amounts should be entered with a minus sign.)

Explain what the following Scheme code is doing:

(define (make-stream n f)
  (define (next m)
    (cons m (lambda () (next (f m)))))
  (next n))

(define head car)

(define (tail stream)
  ((cdr stream)))

(define (nth stream n)
  (if (= n 0) (head stream)
    (nth (tail stream) (- n 1))))

(define even (make-stream 0 (lambda (n) (+ n 2))))

Try it out in Scheme48 and check the values of the following expressions:

even
(head even)
(head (tail even))
(head (tail (tail even)))
(head (tail (tail (tail even))))
(nth even 5)
(nth even 1000)

Explain what the lambda in make-stream is good for, where this function is called, and how tail and nth work. To see what’s going on, trace manually through the execution of

(head (tail (tail even)))

Background: The advantage of wireless signals is that they radiate out in all directions, even penetrating walls to a certain extent. Of course, the very ability of wireless signals also causes problems.

Answer the following questions:

• Describe a situation where we would want to block a wireless signal
• Describe a method to block the signal and provide a link to a source for your method or materials
• Give at least one reason why someone might find your solution impractical

A gas expands from an initial volume of 4.88 L to a final volume of 6.33 L against an external pressure of 810. mmHg. During the expansion the gas absorbs 10. J of heat. What is the change in the internal energy of the gas?

An organic liquid is a mixture of methyl alcohol (CH3OH) and ethyl alcohol (C2H5OH). A 0.220-g sample of the liquid is burned in an excess of O2(g) and yields 0.347 g CO2(g) (carbon dioxide).

Set up two algebraic equations, one expressing the mass of carbon dioxide produced in terms of each reagent and the other expressing the mass of sample burned in terms of each reagent.

What is the mass of methyl alcohol (CH3OH) in the sample?

List the allowed quantum numbers m_l and m_s for the following subshells and determine the maximum occupancy of the subshells. a) 2p b) 3d c) 4f d) 5g

Vancouver manufacturing Ltd. manufactures a variety of high quality electronic components. Data from the last three months are presented below:

You are the controller for Vancouver manufacturing and you are reviewing the performance over the last 3 months. In addition, the controller notes that the company, although it has many detailed performance measures, is considering implementing a balanced scorecard and asks you to identify the measures you think would be most appropriate to include in the balanced scorecard.

Required:

Evaluate the performance of the company and prepare a detailed Balanced Scorecard.

IN PSEUDOCODE AND JAVA SOURCE CODE PLEASE:

Program 0 (Warm-up, 40 pts): Deoxyribonucleic acid, or DNA, is comprised of four bases: (G)uanine, (C)ytosine, (A)denine and (T)hymine. Ribonucleic acid, or RNA, is different than DNA in that it contains no Thymine; thymine is replaced with something called (U)racil. For this assignment, you will create an array of 255 characters. You must start by filling the array with random characters of G, C, A and T.   You must then print out the array. Next, replace all the instances of Thymine with Uracil. Finally, you must print out the array again. In your solution, you must write at least one function that contributes to the solution. You must use the length attribute of the array in your answer.

Sample run

CATGGCGTCTTGCCAAGGCGGTTCCTTGTCTTGATGATGGCTGCGAGTTCCGAGTCGCCTTTTCTATGAGTCGCGAAGTATGCGGTCAAATTATGCTTGTCCGCTGTACTAGGCCCACGGATCTCCTCAGACAGCGTCGATGTCGGAATTCGCGGGGAGGAATACTAAACATGCTGAAGTTGATACATGTACAATTGCCGCGAACCAGGTGCACAGGGTGCCCAACGATCCATGTGGAACGAGAGCGATCTAGCC

CAUGGCGUCUUGCCAAGGCGGUUCCUUGUCUUGAUGAUGGCUGCGAGUUCCGAGUCGCCUUUUCUAUGAGUCGCGAAGUAUGCGGUCAAAUUAUGCUUGUCCGCUGUACUAGGCCCACGGAUCUCCUCAGACAGCGUCGAUGUCGGAAUUCGCGGGGAGGAAUACUAAACAUGCUGAAGUUGAUACAUGUACAAUUGCCGCGAACCAGGUGCACAGGGUGCCCAACGAUCCAUGUGGAACGAGAGCGAUCUAGCC

What are the essential elements of the design side of a systems SAD?

Equivalent Units and Related Costs; Cost of Production Report; Entries

Dover Chemical Company manufactures specialty chemicals by a series of three processes, all materials being introduced in the Distilling Department. From the Distilling Department, the materials pass through the Reaction and Filling departments, emerging as finished chemicals.

The balance in the account Work in Process—Filling was as follows on January 1:

The following costs were charged to Work in Process—Filling during January:

During January, 34,500 units of specialty chemicals were completed. Work in Process—Filling Department on January 31 was 3,000 units, 30% completed.

Required:

1. Prepare a cost of production report for the Filling Department for January. If an amount is zero, enter "0". If required, round your cost per equivalent unit answers to two decimal places.

2. Journalize the entries for (1) costs transferred from Reaction to Filling and (2) the cost transferred from Filling to Finished Goods. If an amount box does not require an entry, leave it blank.

3. Determine the increase or decrease in the cost per equivalent unit from December to January for direct materials and conversion costs. If required, round your answers to two decimal places.

4. Discuss the uses of the cost of production report and the results of part (3).

The cost of production report may be used as the basis for allocating product costs between   and  . The report can also be used to control costs by holding each department head responsible for the units entering production and the costs incurred in the department. Any differences in unit product costs from one month to another, such as those in part (3), can be studied carefully and any significant differences investigated.

Question 1: Rebel without a cause

Two drivers speed head-on toward each other and a collision is bound to occur unless one of them deviates at the last minute. If both deviate, everything is okay (they both win 1). If one deviates and the other does not, then it is a great success for the driver with iron nerves (he wins 2) and a great disgrace for the deviating driver (he loses 1). If both drivers have iron nerves, disaster strikes (both lose 2).

1. Write down the payoff matrix of this game.

2. Briefly (1-2 sentences) define the notion of Nash Equilibrium.

3. What are the Nash equilibria of this game?