Question

In: Biology

Describe the design of the DNA sequence of an artificial chromosome in a typical eukaryote for...

Describe the design of the DNA sequence of an artificial chromosome in a typical eukaryote for expressing an engineered transmembrane protein in the plasma membrane. In your answer list the 9 sequence features this DNA fragment requires to work, briefly state the function of each, and briefly indicate what would go wrong if that sequence feature was missing.

Solutions

Expert Solution

DNA sequence of artificial chromosome for transmembrane protein gene that is expressed in the plasma membrane requires

Transmembrane protein gene sequence

Promotor sequence

ER signal

Nuclear export signal

Plasma membrane targeting sequence

Stop signal sequence

Selection marker sequnces

Restriction site sequences

Reason

Gene sequence is the protein coding sequence without that gene cannot be expressed in eukrayote tra sgenic system

Promotor is important for the gene transcription t where polymerase binds and determines the location of the gene to expresses. Without promotor gene cannot be transcribed

Nuclear export signal helps the mRNA produced to be taken out of nucleus to be converted into the protein by the ribosome without that mRNA will stay inside the nucleus

Stop signal sequence important for the transcription half at the end of the protein coding sequence and without stop signal the gene will not be terminated properly results in inactive protein

Plasma membrane targeting sequence is important for the transmembrane protein to localise the protein of interest info plasma membrane and if not present it cannot be targeted to plasma membrane

Selectable marker sequences are important in production of transgenic eukaryote to select for the integration of the gene

Restriction site sequences are important for the gene to be cloned in a vector


Related Solutions

Describe how eukaryotic DNA is folded into a chromosome
Describe how eukaryotic DNA is folded into a chromosome
describe a typical unreplicated human chromosome from tip to tip
describe a typical unreplicated human chromosome from tip to tip
What types of agents can induce changes in the DNA sequence and what are typical changes...
What types of agents can induce changes in the DNA sequence and what are typical changes observed with each? How are these changes repaired?
Describe the evidence for the fact that DNA is the genetic material and the sequence of...
Describe the evidence for the fact that DNA is the genetic material and the sequence of events leading from the sequence of nucleotides of DNA to the sequence of amino acids in proteins and their secretion. Include in your answer: a. the early evidence for the location of genes on chromosomes, the first evidence that DNA was the genetic material, and that genes determined the structure of proteins b. a description of the mechanisms and structures involved in of transcription...
A DNA sequence is. TACACCTTGGCGACGACT
A DNA sequence is. TACACCTTGGCGACGACT WHAT IS m RNA sequence is _______________________________ mutated sequence is TACACCTTGGGACGACT what is mRNA mutated. ____________________________________ What kind of mutation is this and what would be the result in terms of the amino acid sequence? (hint... use chart in notes
Write down the DNA base sequence that is the complementary strand to the DNA sequence shown...
Write down the DNA base sequence that is the complementary strand to the DNA sequence shown below? (5') C G A C T T C G A G C T (3')
Write sequence of the DNA strand that would be complementary to the DNA sequence shown below....
Write sequence of the DNA strand that would be complementary to the DNA sequence shown below. Label the 3' and 5' ends ofthe new strand. 3'   T A C C G A T G G    5'
Describe the hierarchical approach to determining the DNA sequence of the human genome used by the...
Describe the hierarchical approach to determining the DNA sequence of the human genome used by the Human Genome Project (HGP). Your answer should include descriptions of how physical maps were established and how BAC (bacterial artificial chromosome) libraries facilitated sequencing? (Min 2 and a half pages)
Using a DNA sequence as an example, illustrate and describe the listed mutations - deletion -...
Using a DNA sequence as an example, illustrate and describe the listed mutations - deletion - insertion - nonsense mutation - substitution - back mutation
Compare to this DNA sequence: 1. Forward sequence: GAATAATTTAACTATTCTCTGTTCTACATGGGGAGCAGATTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATCTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTAACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAG
Compare to this DNA sequence: 1. Forward sequence: GAATAATTTAACTATTCTCTGTTCTACATGGGGAGCAGATTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATCTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTAACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTACCACACATCAACTGCAACTCCAAAGCCACCTCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGAAAACCCTTGACCAACCATCCTCCAGGGCCGAGGGTAATTTCTTTTGGTTTCATTCTAAAGGCACCATTGTGCGACTTTCTATTTGAACTCAAGGGCAGTTTCTTTATTCCTCTCCCTTTACTCTCGCATCCTTAAAGGAAAAGGAGGTTTCGAATTCCCCCCTGTCTAATTGTTAGAGCACACATAGGCGATCGTTCTATAACTCAGCACAAACCGGGGGGAAAAACATTTCATAGGGGCACTAAGTCTCGGATTCCCCATCTTCCCCCGGGGGCTGGGCGGGTAGCCCCTTGAAAACACTAGACCCTTCGGTGGTAAAAATTGCCTACAACCGAATTAAAAAATGAGAGCCGTTTTTCCTGGC Reverse sequence: ATTTTGAGGGGGCTTCTTGGGGGGCGAGTAGGATTGACTCGTGATGTGCTATGTACGGTAATGGCTTTATGTACTATGTACTGTTAAGGGTGGGTAGGTTTGTTGGTATCCTAGTGGGTGAGAGGTGGCTTTGGAGTTGCAGTTGATGTGTGGTAGTTGAGGGTTGATTGCTGTACTTGCTTGTAAGCATGGGGAGGGGGGTTTTGATGTTGGATTGGGTTTTTTATGTACTACAGGTGGTTAAGTATTTTATGGTACCGTGCAATTATTTCATGGGTGGCTGGGCAGTATTGTACGGAGATACCATAGCGGGTTGGTTGGATGGGGTAAAGTCATTAATTTGGGGTGGGTACCCCAAATCTGCTTCCCCCATGAAAAGAAACAGAGAATAAGTTTTAATTTTGGTTTCTTTAGCTTTGGGGTGCTTAATGGGGGGGAGGTTAAAAAACCCCCCCGCCGTTTCCCGGGGGGGGGGGGGGGGGCAACCTTCCCCGGGCCCGGGGGGAAAACTAACCCGTATGGACAGTCTTCCAATCACGTCAAAGTTTAGGTCTTTTTATATTACTTCAATGGGGCTGGGGGACGTTCGGGAAAACGGGTGACCCATTGGGGGGTTAATCACCTTGGGGGATAGTCCGGTGGGGGAGCTGGCCCAAGTGCCCAATATCAACGTGGTGACGGGGGGGTGGGGGGGGGGCGGTGGGGTCTCGAAA
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT