Question

In: Biology

Experiment 2: Cloning a DNA Fragment to a Bacterially-Derived Plasmid Vector Bacteria frequently contain extrachromosomal plasmids,...

Experiment 2: Cloning a DNA Fragment to a Bacterially-Derived Plasmid Vector

Bacteria frequently contain extrachromosomal plasmids, which are circular DNA genetic elements that are self-replicating. Plasmids are typically not necessary for the bacteria's survival but can sometimes confer a growth advantage to the bacteria. Plasmids can be transferred between bacteria and recombinant DNA technology makes use of this feature to introduce “foreign” genes into bacteria and use the bacteria as a cell “factory” to produce the gene. Genes are inserted into plasmids (also called vectors) by means of restriction enzymes. Restriction enzymes are bacterially derived enzymes that recognize specific DNA sequences and cut (or restrict) that particular DNA sequence in a consistent way. That is, any DNA that contains a particular restriction enzyme sequence will be cut the same. Restriction enzymes often produce overhanging ends of DNA (called sticky ends) that can adhere to each other through hydrogen bonding then DNA ligase permanently links the pieces together by forming covalent bonds between the phosphate backbones of the DNA, creating a recombinant or genetically engineered DNA. In this experiment, you will be given two sequences of DNA: one sequence is a foreign gene and the other sequence is of a plasmid vector. You will use a computer program to identify where the common restriction sites for both sequences occur. Scientists perform this type of computer simulation prior to performing restriction enzyme digestion to ensure that they will cut the sequences as expected.

Materials

NEB Cutter Website: http://tools.neb.com/NEBcutter2/index.php
Computer with Internet access.
Foreign Gene Sequence (provided in experimental procedure)
Plasmid Gene Sequence (provided in experimental procedure)

Procedure

Type the link listed in the materials box for the NEB Cutter website into a web browser (note, cutting and pasting the link from a PDF file format will not work. You must manually type in the address).

Copy and paste the foreign DNA sequence into the box on the NEB Cutter website where it says “Paste In Your DNA Sequence”. Foreign DNA Sequence:

GAATTCGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGT

CGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGC

GAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGG

CAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGC

AGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCG

CCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCA

ACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCA

TCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGC

TGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAAC

GGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGC

TCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCC

CGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGC

GCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATG

GACGAGCTGTACAAGGGATCC

Title the sequence as “Foreign DNA” in the “Name of Sequence” box. Leave the other settings on their default status.

Click the “Submit” button (located to the right of the pasted DNA sequence).

On the new page that opens, select “Custom Digest” under the “Main Options” heading on the left side of the page.

The new page that opens will contain a list of restriction enzymes. Select the enzymes BamHI and EcoRI then click on the “Digest” button at the bottom of the page.

On the new page that opens you will see a linear representation of your DNA. Select “Fragments” under the “List” heading on the right side of the page.

Record the length of the longest fragment in Table 1. This fragment contains the sequence of the foreign DNA. The short fragments are the left over ends from the restriction enzyme digest. Close this window.

Return to the NEB Cutter homepage. Copy and paste the plasmid gene sequence into the box on the NEB Cutter website where it says “Paste In Your DNA Sequence”. Plasmid DNA Sequence:

GTTAACTACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTG

TTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATA

AATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCG

CCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACG

CTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATC

GAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGT

TCTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTG

TTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACT

TGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAG

AGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTT

CTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGG

GATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAA

ACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAAC

TATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATG

GAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGG

TTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGC

ACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGT

CAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGAT

TAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTACCCC

GGTTGATAATCAGAAAAGCCCCAAAAACAGGAAGATTGTATAAGCAAATATTTAAATT

GTAAACGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTT

AACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGCCCGAGATA

GGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCC

AACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATC

ACCCAAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAA

AGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCGAACGTGGCGAGAAAGGAAG

GGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGC

TGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTAAAA

GGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTT

TTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCC

TTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGT

GGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAG

CAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTT

CAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGC

TGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACC

GGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTG

GAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGC

CACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGA

ACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCC

TGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGG

GCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTG

CTGGCCTTTTGCTCACATGTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTT

ACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCAC

ACAGGAAACAGCTATGACCATGATTACGCCAAGCTACGTAATACGACTCACTATAGGG

CAGATCTTCGAATGCATCGCGCGCACCGTACGTCTCGAGGAATTCCTGCAGGATATC

TGGATCCACGAAGCTTCCCATGGTGACGTCACCGGTTCTAGATACCTAGGTGAGCTC

TGGTACCCTCTAGTCAAGGCCTATAGTGAGTCGTATTACGGACTGGCCGTCGTTTTAC

AACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCC

CCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACA

GTTGCGCAGCCTGAATGGCGAATGGCGCTTCGCTTGGTAATAAAGCCCGCTTCGGCG

GGCTTTTTTTT

Title this sequence as “Plasmid DNA” in the “Name of Sequence” box. Select “Circular” by the heading “The sequence is:”. Leave the other settings on their default status.

Click the “Submit” button (located to the right of the pasted DNA sequence).

On the new page that opens, select “Custom Digest” under the “Main Options” heading on the left side of the page.

The new page that opens will contain a list of restriction enzymes. Select the enzymes BamHI and EcoRI then click on the “Digest” button at the bottom of the page.

On the new page that opens you will see a circular representation of your DNA. Select “Fragments” under the “List” heading on the right side of the page.

Record the length of the longest fragment in Table 1. This fragment contains the majority of the plasmid DNA sequence. The short fragment is the excised plasmid DNA that lies in between the two restriction enzyme sites.

Table 1: Fragment Lengths
DNA Type Longest Length (in base pairs)
Foreign
Plasmid

Q: Identify where the common restriction sites for both sequences occur?

Solutions

Expert Solution

The final results after completing all the steps are as below:

The restriction site after custom digest is shown below:

As we can see, in foreign DNA, ECoRI site is interfered by CpG island. So only BamHI is present in boh foreign DNA and plasmid DNA.

Identify where the common restriction sites for both sequences occur?

Common restriction sites occur by BamHI


Related Solutions

Experiment 2- Cloning a DNA Fragment to a Bacterially-Derived Plasmid Vector “Table 1: Fragment Lengths” “DNA...
Experiment 2- Cloning a DNA Fragment to a Bacterially-Derived Plasmid Vector “Table 1: Fragment Lengths” “DNA Type” “Longest Length (in base pairs)” “Foreign” 720 “Plasmid” 2804 1. What is the expected size of the plasmid plus the cut foreign DNA? 2. What type of ends to the enzymes BamHI and EcoRI produce? How does this type of end facilitate cloning? 3. What enzyme is necessary to permanently link the digested foreign and plasmid DNA together to form the recombinant DNA...
Experiment 3: Cloning a DNA Fragment into a Bacterially-Derived Plasmid Vector Foregin DNA = 720 Plasmid...
Experiment 3: Cloning a DNA Fragment into a Bacterially-Derived Plasmid Vector Foregin DNA = 720 Plasmid DNA 2804 Post-Lab Questions 1. What is the expected size of the plasmid plus the cut foreign DNA? 2524 base pairs 2. What type of ends do the enzymes BamHI and EcoRI produce? How does this type of end facilitate cloning? 3. What enzyme is necessary to permanently link the digested foreign and plasmid DNA together to form the recombinant DNA molecule? How does...
Cloning a DNA Fragment to a Bacterially-Derived Plasmid Vector” “Table 1: Fragment Lengths” DNA TYPE: LONGEST...
Cloning a DNA Fragment to a Bacterially-Derived Plasmid Vector” “Table 1: Fragment Lengths” DNA TYPE: LONGEST LENGTH FOREIGN: 716 PLASMID: 2837 Post-Lab Questions 1. What is the expected size of the plasmid plus the cut foreign DNA? 2. What type of ends to the enzymes BamHI and EcoRI produce? How does this type of end facilitate cloning? 3. What enzyme is necessary to permanently link the digested foreign and plasmid DNA together to form the recombinant DNA molecule? How does...
If cloning of a 0.8 kb DNA segment was performed at the PstI site of plasmid...
If cloning of a 0.8 kb DNA segment was performed at the PstI site of plasmid pBR322 and the E. coli strain HB-101 was transformed with the construct: a) What is the selection criteria for E. Coli transformants with the recombinant plasmid ?: -Ecoli growth in nutrient-rich culture medium____ -Ecoli growth in culture medium rich in nutrients plus ampicillim_____ - Growth of E. coli in a culture medium rich in nutrients plus tetracycline_____ -Ecoli growth in culture medium rich in...
Discuss the following research techniques 1. DNA ligase 2. Plasmid vector
Discuss the following research techniques 1. DNA ligase 2. Plasmid vector
1.) Describe the four stages of genetic engineering: cleave DNA & insert into cloning vector -producing...
1.) Describe the four stages of genetic engineering: cleave DNA & insert into cloning vector -producing recombinant DNA, insert recombinant vector into bacterial cells -cloning, amplification of recombinant vector, screening for recombinant DNA. 2.) What and how are antibiotic resistance and the lacZx gene used in screening? 3.) What is Agrobacterium tumefaciens? What normally occurs upon Agrobacterium tumafaciencs infection in plants? How is it used to genetically engineer plants (stably insert foreign genes into plants)?
Genetics Essay 1. Describe DNA vector cloning. In your description, make sure to include: a) the...
Genetics Essay 1. Describe DNA vector cloning. In your description, make sure to include: a) the process (steps) b) three things that a plasmid cloning vector must have c) an explanation of how blue and white screening works during DNA recombinant technology
If you would do a PCR experiment using the Klenow fragment of the E.coli DNA polymerase...
If you would do a PCR experiment using the Klenow fragment of the E.coli DNA polymerase I instead of Taq DNA polymerase, what would you have to change in the experimental set-up and explain why?
Arthur is conducting an experiment of plasmid insertion. He has prepared some live bacteria and gone...
Arthur is conducting an experiment of plasmid insertion. He has prepared some live bacteria and gone through all essential steps of plasmid insertion in a correct manner: i) Cut open the plasmid by restriction enzyme and insert the gene by DNA ligase. ii) Insert the plasmid into bacteria by heat shock. iii) Grow the plasmid-containing bacteria in culture plate. However, after incubation, he failed to observe any successful cloning. Assuming the enzymes involved could function properly. List and expain FIVE...
A 2 kb fragment of DNA was cut by EcoRI and BamHI and then analyzed by...
A 2 kb fragment of DNA was cut by EcoRI and BamHI and then analyzed by gel electrophoresis. The following fragment sizes were produced: EcoRI: 900, 700, 400 BamHI: 1100, 900 In order to map the location of each restriction site, each fragment was then digested with the other two restriction enzymes. The following was obtained: BamHI-Treated EcoRI-Treated Original Fragment Size 700, 200 - 900 EcoRI 700 - 700 400 - 400 - 700, 400 1100 BamHI - 700, 200...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT