Prokaryotic DNA Pol III cannot catalyze nick translation. Why? a. It lacks 3'-5' exonuclease activity b....

Prokaryotic DNA Pol III cannot catalyze nick translation. Why? a. It lacks 3'-5' exonuclease activity b. It lacks 5'-3' exonuclease activity c. It lacks 3'-5' endonuclease activity e. It lacks 5'-3' endonuclease activity e. none of the above

Which of the following enzyme activity enables DNA Pol I to edit its mistakes? a. 3'-5' exonuclease activity b. 5'-3' exonuclease activity c. 3'-5' endonuclease activity d. 5'-3' endonuclease activity e. none of the above

How is mRNA translated? a. 5' 3' direction b. 3' 5' direction c. amino-to-carboxyl direction d. carboxyl-to-amino direction e. none of the above

Which of the following processes is not a part of gene expression? a. replication b. transcription c. processing of mRNA d. translation e. none of the above

Expert Solution

1) b. It lacks 5'-3' exonuclease activity

Prokaryotic DNA Pol III cannot catalyze nick translation, because it lacks 5'-3' exonuclease activity. Prokaryotic DNA Pol I catalyze nick translation due to 5' -3' exonuclease activity.

Which of the following enzyme activity enables DNA Pol I to edit its mistakes?

2) a. 3'-5' exonuclease activity

In, prokaryotic all three DNA polymerases have the ability to proofread, using 3’-> 5’ exonuclease activity. The 3'-> 5' exonuclease activity of DNA polymerase I proofreads newly synthesized DNA, removing mismatched nucleotides.

3) c. amino-to-carboxyl direction

The sequence of nucleotides in the template

m- RNA chain determines the sequence of amino acids, which are generated in amino acid chain. Addition of an amino acid occurs at the C-terminus of the peptide and thus translation is said to be amino-to-carboxyl directed.

4) a. Replication

Replication is not a part of gene expression. It is a part of cell division. It is a process that happens when DNA needs to be divided in mitosis.

queen_honey_blossom answered 2 years ago

Transcription and Translation 1. Double strand of DNA: 5’-ATGTACCAGCATTCTCGATACCCT-3’ 3’-TACATGGTCGTAAGAGCTATGGGA-5’ mRNA strand made from the DNA:...

Transcription and Translation 1. Double strand of DNA: 5’-ATGTACCAGCATTCTCGATACCCT-3’ 3’-TACATGGTCGTAAGAGCTATGGGA-5’ mRNA strand made from the DNA: 5’-AUGUACCAGCAUUCUCGAUACCCU-3’ a) Which strand of the DNA is the template for mRNA synthesis? Select the correct answer: i. 5’ – 3’ ii. 3’ – 5’ (0.5 points) b) Draw an arrow on the DNA above, to show the direction of transcription i.e. in which order the nucleotides were added to create mRNA. (0.5 points) c) What is the peptide sequence of this piece of...

1. Write chemical reactions for both DNA polymerization activity and 3'-->5' exonuclease activity of a DNA...

1. Write chemical reactions for both DNA polymerization activity and 3'-->5' exonuclease activity of a DNA polymerase. Are the 2 reactions reversible to each other? Explain why 3'-->5' exonuclease activity is essential for a high fidelity DNA polymerase.

DNA polymerase III builds new DNA strands in the 5' to 3' direction...always adding the new...

DNA polymerase III builds new DNA strands in the 5' to 3' direction...always adding the new nucleotide to the 3' end of the existing strand. As it adds new nucleotides, it proofreads its work. If a mistake is detected, DNA polymerase will act as an exonuclease and excise the incorrect nucleotide. A. What supplies the energy needed to add the new nucleotide to the existing chain? B. Please explain why evolution has favored 5’ to 3’ polymerases, as opposed to...

Activity Predecessor Activity Duration in Weeks A ---- 3 B A 5 C A 7 D...

Activity Predecessor Activity Duration in Weeks A ---- 3 B A 5 C A 7 D B 10 E C 5 F D, E 4 Using the Critical Path Method (CPM), find the critical part, activities, and the date to finish the project (Gantt Chart would help). I would really appreciate excel screenshots!

Which of these DNA sequences is palindromic when double-stranded? A) 5-ATGGTA-3 B) 5-GGGCCC-3 C) 5-ATCCAT-3 D)...

Which of these DNA sequences is palindromic when double-stranded? A) 5-ATGGTA-3 B) 5-GGGCCC-3 C) 5-ATCCAT-3 D) 5-ATGATG-3

DNA methyltransferase: A) Recognizes hemimethylated 5’-CpG-3’ sites on double stranded DNA B) Adds a methyl group...

DNA methyltransferase: A) Recognizes hemimethylated 5’-CpG-3’ sites on double stranded DNA B) Adds a methyl group to select cytosine bases in the DNA C) Is inhibited by decitabine D) All of the above E) None of the above Angelman Syndrome and Prader Willi Syndrome revealed that a similar chromosomal deletion could manifest as two very different (phenotypically distinct) syndromes. The genetic basis for the difference: Arises from changes in transcription due to promoter swapping at the deletion site. Depended on...

Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse...

Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse and 3'-->5' it goes forward.......I got lost after this. Please explain. Will give a thumbs up. ----- Which of the following sets of primers could you use to amplify the target DNA sequence below, which is part of the last protein-coding exon of the gene involved in cystic fibrosis? 5’- ggctaagatctgaattttccgag … ttgggcaataatgtagcgcctt - 3’ 3’- ccgattctagacttaaaaggctc … aacccgttattacatcgcggaa – 5’ a) 5’ GGAAAATTCAGATCTTAG...

Explain why each of the names is incorrect a) 2,2-dimethyl-6-ethylheptane b) 5-ethyl-3-methylheptane c) 2-Isopropyl-4-methylheptane d) 5-methylcyclohexanol...

Explain why each of the names is incorrect a) 2,2-dimethyl-6-ethylheptane b) 5-ethyl-3-methylheptane c) 2-Isopropyl-4-methylheptane d) 5-methylcyclohexanol e) 1-bromo-4-pentanol f) 2-methyl-N, N-dimethyl-4-hexamine g) 4-bromo-3-pentanol

Question