Given the following CODING STRAND of DNA: ATG TTT CAT GGC TGA TAA - What is...

Given the following CODING STRAND of DNA: ATG TTT CAT GGC TGA TAA

- What is the complimentary template strand of DNA?

- What would be the mRNA CODON sequence?

- What is the anti-CODON of tRNA? And which AMINO ACID would the tRNA bring?

Solutions

Expert Solution

The sequence of DNA that is copied during the synthesis of mRNA are referred to as Template strand.

To display the DNA sequence coding strand is used. It is presented in 5' to 3' direction.

DNA contains two antiparallel strands of polynucleotides composed of

A(adenosine)
T(thyamin)
C(cytidine)
G(guanosine)

In RNA T is replaced by U(uracil).

A forms two hydrogen bonds with T in DNA and with U in RNA. While C forms three hydrogen bonds with G.

Complementary strand for DNA sequence is

TAC AAA GTA CCG ACT ATT

mRNA has three nase pairs long part of mRNA that codes for specific amino acid in ribosome of cell. Therefore mRNA codon sequence would be:

AUG UUU CAU GGC UGA USA

Note: In RNA T is replaced by U.

anti-CODON of tRNA is a sequence of three bases that are complementary to a CODON in mRNA.

Example: tRNA having anti-CODON GCG codes for alanine amino acid is complementary to CODON CGC codes fif argenine amino acid.

Sydney Mullin answered 1 year ago

Next > < Previous

Related Solutions

Given the DNA strand, 3’ TTG-TAA-CGC-CAT-ATG-GAC-AGC 5’, what is the resulting amino acid sequence of this...

Given the DNA strand, 3’ TTG-TAA-CGC-CAT-ATG-GAC-AGC 5’, what is the resulting amino acid sequence of this polypeptide? . What tRNA anti codon would bind to each mRNA codon in the last part? Draw how this works by drawing the mRNA interacting with the tRNA in the ribosome.

The codon in the DNA coding strand has the following sequence: 5' - TAC -3' Which...

The codon in the DNA coding strand has the following sequence: 5' - TAC -3' Which of the following codons (result of a mutation) represents a non-sense mutation? Select one: a. TAA b. TAT c. TTC d. TCC

4. This is a coding DNA : 5’ ATG AGT GAT CTA GAC AGA CTT GCA...

4. This is a coding DNA : 5’ ATG AGT GAT CTA GAC AGA CTT GCA AGC CGG …3’ (a) Predict the complementary strand and identify the strand name of it. (3' --> 5’) (b) Predict the mRNA sequence (5' --> 3’) for the given coding strand. (c) Predict the amino acid sequence of the gene. (d) Predict the amino sequence, if there is a base substitution from A to T at the 16th base. (e) Which type of mutation...

The sequence below represents the coding DNA strand of the start of a gene, including part...

The sequence below represents the coding DNA strand of the start of a gene, including part of the 5' untranslated region. (5')...TCGGAAGGAGGTAGCGGCAATGGGGAAAAGTATTGCTT...(3') In studying variants of this gene in disease, a nucleotide mutation of A→T was detected in the first base of the third codon. What effect would this mutation have? (When considering your answer, assume standard initiation of translation is numbered as codon 1.) Select one: a. Terminates translation b. No effect c. Disrupts ionic interactions at physiological pH...

Define the following terms (a) leading strand (b) lagging strand (c) template strand (d) coding strand

1. Given the non-template strand of DNA, draw the template strand with the 5' and 3'...

1. Given the non-template strand of DNA, draw the template strand with the 5' and 3' ends labeled. Draw the RNA molecule with the proper 5' and 3' ends labeled Non-Template Strand: 3'- AAT GCT CGT AGC TTC GAT CGG ATC GA-5' 2. How many amino acids would the RNA molecule code for?

Given the non-template strand of DNA, draw the template strand with the 5' and 3' ends...

Given the non-template strand of DNA, draw the template strand with the 5' and 3' ends labeled. Draw the RNA molecule with the proper 5' and 3' ends labeled Non-Template Strand: 3'- AAT GCT CGT AGC TTC GAT CGG ATC GA-5' My answers: Template= 5'- TAT CGA GCA TCG AAG CTA GCC TAG CT-3' RNA Molecule= 3'- AUA GCU CGU UGC UUC GAU CGG AUC GA-5' Next it asks, how many amino acids would the RNA molecule code for? -...

Answer the following questions using the sequence given below. Non-template DNA 5’ – ATG CGT TCG...

Answer the following questions using the sequence given below. Non-template DNA 5’ – ATG CGT TCG TTA TGG CTG CTT – 3’ 1. Provide sequence of template DNA 2. Provide sequence of mRNA 3. Provide sequence of tRNA anticodon for the 3rd triplet 4. Provide the sequence of the amino acid encoded by the mRNA 5. What is the effect on the amino acid sequence as a result of each of the following mutations? substitution of T for G at...

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA...

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA strand look like? What would the protein look like? Create a point mutation in the DNA and then give the mRNA and protein sequence. Create a frameshift mutation in the DNA and then give the mRNA and protein sequence.

Given the half of the DNA strand: 5'-GTTAGCCGTCTAATATGGTGAGATGTTATAACCCGCAGTTTACAACTTCAA-3' 1.At what part is of the peptide is...

Given the half of the DNA strand: 5'-GTTAGCCGTCTAATATGGTGAGATGTTATAACCCGCAGTTTACAACTTCAA-3' 1.At what part is of the peptide is where Arg located? At what part of the peptide is where the stop codon located? Where is the 5th cytosine located at the RNA strand? Where is the 6th uracil located at the RNA strand? How many Leu amino acids are transcribed? How many Pro amino acids are translated? What is the 7th amino acid translated? What is the 7th amino acid translated?

Subjects