Question

In: Psychology

4-6 sentences each 1. Describe the developmental vs. difference controversy (include similar sequence hypothesis and similar...

4-6 sentences each

1. Describe the developmental vs. difference controversy (include similar sequence hypothesis and similar structure hypothesis as well as difference viewpoint)

2. Identify causes for ID

3. How would we treat ID?

4. What are some other issues (behavioral/ emotional or physical) that children with ID would display?

Solutions

Expert Solution

1. Developmental hypothesis in children with intellectual disability (ID) is of the opinion that children with still go through the same processes and hallmarks of development as a normal child would, but it's usually delayed in its trajectory.

Whereas the different hypothesis states that children with ID don't follow the normal trajectory of development as a normal child would - it is either incomplete and/or not in the chronological order of developmental hallmarks.

2. Cause of ID can be many, it could be teratogens (substances the mother used while pregnant) , or it could be genetical, it could be physical injury caused to the in fact in uetro or the like.

3. ID so far is not curable yet, but there are ways that I'd can be managed. This is generally decided as per cases that range from mild to severe. The former being easier to manage and handle than the latter that calls for more dependency. But through special training certain basic sustenance skills can be taught.

4. Children with ID can display a few issues in the emotional, Behavioral or physical realm. They might have problem with communication which an pose emotional problems. They might also have other problems along with ID which can range from attacks of seizures or difficulty in integrating information from their sense organs.


Related Solutions

Each paragraph shall be no less than 4 sentences and no more than 6 sentences. 1....
Each paragraph shall be no less than 4 sentences and no more than 6 sentences. 1. A patients has an elevated WBC of 11000. a. As a nurse what are the risks for infection, your goal, your intervention, and your rationale?
Respond to each of the following questions in 4-6 Sentences or more. How should agriculture be...
Respond to each of the following questions in 4-6 Sentences or more. How should agriculture be incorporated into economic development plans? Is your answer dependent on the characteristics of the economy we are talking about (rich/poor, small/large)? Do you think relief and aid should usually be provided in the form of cash or goods (e.g., TOMS shoes)? Why, and under what circumstances? Should genetically modified crops be subject to stricter regulation and labelling? Why or why not?
Describe how the blood flows through the heart (similar to a circuit), include each step using...
Describe how the blood flows through the heart (similar to a circuit), include each step using the medical terms . Describe how and why blood needs to be sent to the lungs and why it is then sent back to the heart.
Complete the following exercises, in 2-4 sentences each and include a paragraph explaining how you can...
Complete the following exercises, in 2-4 sentences each and include a paragraph explaining how you can apply what you've learned in this chapter to your job. Write a short note on the Consolidated Omnibus Budget Reconciliation Act of 1986. What is workers' compensation? Mention some common features that all states' workers' compensation laws share. Describe some measures that firms have taken to gain tighter management control over the cost of health care. Discuss some of the trends that are helping...
Respond to each question below in 4-6 sentences or more to receive a thumbs up. Some...
Respond to each question below in 4-6 sentences or more to receive a thumbs up. Some actions by the poor may appear to be counterproductive (e.g., smoking, gambling, crime). In what ways do you think institutions force these choices. What other factors should we consider in addressing these issues? Why do you think the poor are primarily engaged in self-employment? Would it help for them to shift into wage employment, and what policies might encourage them to do so?
Describe briefly (4-6 sentences) what factors are responsible for influencing what face of a π-system in...
Describe briefly (4-6 sentences) what factors are responsible for influencing what face of a π-system in a chiral environment a reagent will attack from.
6. The following sequences are mutations of the template sequence in question 1. For each mutated...
6. The following sequences are mutations of the template sequence in question 1. For each mutated sequence, indicate the new amino acid sequence produced and the type of mutation that is the end result in the amino acid (frameshift, Missense, nonsense, silent) as well as the type of mutation that occurred in the DNA sequence (substitution, addition, deletion) Template sequence question 1: 3’ TACCCTGGTGGTTTGCGGACT 5’ a. 3’ TAC CCG GTG GTT TGC GGACT 5’ b. 3’ TAC ACT GGTGGTTTGCGGACT 5’...
Briefly write 4-5 short sentences on each of the 6 topics below. Explain its relevance to...
Briefly write 4-5 short sentences on each of the 6 topics below. Explain its relevance to that of a financial manager. 1) Financial Statement Analysis 2) Working Capital Management 3) Time Value of Money 4) Risk and Return Tradeoff 5) Securities Valuation 6) Capital Budgeting
Provide 3-4 detailed sentences on each the questions below. 6) What are the three basic reimbursement...
Provide 3-4 detailed sentences on each the questions below. 6) What are the three basic reimbursement methods for inpatient hospital services? 7) Why is comorbidity important in coding? 8) What information is included in a charge description master (CDM)? 9) What are the four sections of the UB-04 claim form? 10) What types of institutional facilities use the UB-04 claim form?
1. In no more than 1-2 sentences, describe how each of the following contributed to the...
1. In no more than 1-2 sentences, describe how each of the following contributed to the onset of the financial crisis: a. Bursting of the housing bubble b. A global savings surplus c. Subprime lending d. Decline in lending standards and securitization e. Sharp increases in oil prices
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT