Question

In: Chemistry

The largest human DNA molecule is a double helix consisting of two complementary polynu- cleotide chains,...

The largest human DNA molecule is a double helix consisting of two complementary polynu- cleotide chains, each chain in turn being made up of about 250 million linked nucleotides (i.e., 250 Mbp). Given that the average molecular weight of a nucleotide is about 325 g/mol and that there are 2.2 pounds in one kilogram, show the calculation of the mass in pounds of one mole of this DNA molecule.

Solutions

Expert Solution

Ans. Total number of nucleotides in the dsDNA molecules =

                                    2 strands x (Number of nucleotides / strand)

                                    = 2 strands x (250 x 106 nucleotides/ strand)

                                    = 500 x 106 nucleotides.

Given, molar mass of 1 mol nucleotides = 325 g/ mol

So, Mass of 1 molecule of nucleotide = Molar mass / Avogadro number

                                                = (325 g/ mol) / NA              ; [NA = Avogadro number]

Mass of 1 DNA molecule = Number of nucleotides x Mass of 1 nucleotide

                                                = (500 x 106 nucleotides) x [(325 g/ mol) / NA]   

Molar mass of DNA = Mass of 1 DNA molecule x Avogadro number

                                    = (500 x 106 nucleotides) x [(325 g/ mol) / NA]    x NA

                                    = 1.625 x 1011 g/ mol

Thus, the mass of 1 mol DNA = 1.625 x 1011 g

                                                = 1.625 x 1011 x 10-3 kg                               ; [1 g = 10-3 kg]

                                                = 1.625 x 108 kg

                                                = 1.625 x 108 x 2.2 lb                                    ; [1 kg = 2.2 lb]

                                                = 3.575 x 108 lb

Therefore, mass of 1 mol DNA = 3.575 x 108 lb


Related Solutions

( This is the 3 topic for question 1) DNA is a double-stranded helix, DNA and...
( This is the 3 topic for question 1) DNA is a double-stranded helix, DNA and RNA are polymers of nucleotides, DNA replication depends on specific base pairing 1) Post three topics or quotes that you found interesting from chapter 10, and explain why. Also respond to at least three other classmates using the 3C+Q method. 2) Name three changes that you could make to decrease your ecological footprint. 3) What can we do to preserve and restore biodiversity? 4)...
The following is a sequence of nucleotides in a DNA double helix that codes for a...
The following is a sequence of nucleotides in a DNA double helix that codes for a short polypeptide. The messenger RNA encoded by this DNA has both translational initiation and termination codons.                                     STRAND A: T T T A G T T A T C A A T C T T G G G T A G A A C                                     STRAND B: A A A T C A A T A G T T A G A A C...
Which one of the following DNA chains is both complementary and anti-parallel to this DNA chain:...
Which one of the following DNA chains is both complementary and anti-parallel to this DNA chain: 5' GGGTTT 3'? (it can be more than one answer) 5' TTTGGG 3' 5' GGGTTT 3' 5' CCCAAA 3' 5' AAACCC 3'
The term "double helix" as it is used to describe DNA refers to the the fact...
The term "double helix" as it is used to describe DNA refers to the the fact that DNA is comprised of 2 DNA strands that are twisted together to form a spiral. True False The genotype ratio compares the number of times each genotype would be produced in the offspring of a mating. True False If one strand of a segment of DNA has a base sequence of A-G-C-A-T, its complementary strand would be T-C-G-T-A. True False t RNA: carries...
Describe the 3 structures the DNA double helix could exist in.
Describe the 3 structures the DNA double helix could exist in.
Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA...
Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA replication: ATCGGCTAGCTACGGCTATTTACGGCATAT TAGCCGATCGATGCCGATAAATGCCGTATA
Name the three components of a DNA nucleotide. Explain how the DNA double helix is formed...
Name the three components of a DNA nucleotide. Explain how the DNA double helix is formed including the Base Pairing rules and the Antiparallel structure.
The enzyme that unwinds the DNA double helix is called DNA gyrase                c. helicase primase             
The enzyme that unwinds the DNA double helix is called DNA gyrase                c. helicase primase                       d. ligase RNA polymerase has 5’- 3’ exonucleases 3’- 5’ exonucleases both exonucleases no exonucleases                                                                 In the synthesis of RNA the addition proceeds by     attack of the 3’OH to the a phosphate of the incoming NTP attack of the 3’OH to the a phosphate of the incoming dNTP attack of the 5’OH to the a phosphate of the incoming NTP attack of...
List the five DNA condensation levels starting from the DNA double helix. Make sure to describe...
List the five DNA condensation levels starting from the DNA double helix. Make sure to describe what the structure looks like, the size of each structure, and what proteins, if any, are involved.
TRUE OR FALSE To enable replication of DNA the double helix needs to be opened forming...
TRUE OR FALSE To enable replication of DNA the double helix needs to be opened forming replication forks
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT