1. After completing your mutagenesis experiment you set out to determine which gene was responsible. To do...

1. After completing your mutagenesis experiment you set out to determine which gene was responsible. To do so you sequenced the DNA of 100 mutant worms. Listed below is the sequence of a portion of chromosome 1 for 10 of these worms. Circle the nucleotide that is the likely causative mutation for the mutant phenotype.

WILDTYPY SEQUENCE:

5’ AACTCCCTTCTTGGACTACCAGACCTGGGATCCTCTAGCATTCAAGGCT 3’

5’ AACTGCCATCATGGACTACCTGACCTGCGAACCTCTAGCATTCAAGGCT 3’

5’ AACTGCCATCTTCGACTACATGACCAGCCAACCTCTAGCATTCAAGGCT 3’

5’ AACTCCCATCTTGGATTACCTGACCTGCGAACCTCTAGCATTCAAGGCT 3’

5’ AACTCCCATCTTGGACTACCTGACCTGCGAACCTCTAGCATTCAAGGCT 3’

5’ AATTGCCAACTTGGTCTAGCTGACCTGCAAACTCTAGCATACAAGGCT 3’

5’ AACTGCCATCTTGGACTACCTCACCTGCGATCCTCTAGCAATCAAGGCT 3’

5’ AACTCCCTTCTTGGACTACCAGACCTGCGATCCTCTAGCATTCAAGGCT 3’

5’ AACTGCCATCTTGGACTACCTGACGTGCGATCCTCTAGCATTGAAGGCT 3’

5’ AACTGCCATCTAGGACTACCTGACCTGCCAACCTCTAGCTTTCAAGGCT 3’

Expert Solution

Answer : The given seqnece was written in proper format for clustal w alignment & the yellow space marked for wild type sequence number 7 is the mutation. Provided below are the alignment sequence for DNA

gladiator answered 2 years ago

After completing your literature review for your dissertation, you determine that there appears to be a...

After completing your literature review for your dissertation, you determine that there appears to be a strong relationship between Emotional Intelligence (EI) and leadership performance (TFL). Thus, leaders that are more emotionally intelligent appear to perform better than those that are not. You are excited by the research and are interested in testing the theory. Thus, in your methodology section (chapter 3) of your proposal you decide to conduct a correlational study. In doing so, you are first charged with...

1. Retirement Savings After completing your MBA, you are committed to saving for retirement. To do...

1. Retirement Savings After completing your MBA, you are committed to saving for retirement. To do so, you plan to maximize your contributions to your tax-deferred (401k) retirement account. You plan to invest your savings in low-cost equity mutual funds. In your opinion, this will give you an 8% effective annual rate of return. You plan to work 30 years, then retire. A. What is the APR with monthly compounding that will yield an effective annual rate of 8%? B....

What career plans do you have after completing your degree? Review the mission statement of the...

What career plans do you have after completing your degree? Review the mission statement of the College of Nursing and Health Care Professions, your program of study, and the welcome message on the college's main page of the GCU website. Discuss how the college's mission and your program of study align with your career plans. Formulate three personal and three professional goals that you believe will help you successfully complete your program and obtain the career to which you aspire.

You are required to show all work, which will include completing the following steps: Determine your...

You are required to show all work, which will include completing the following steps: Determine your null and alternative hypotheses (see Slide 11) Set up a table (see Slide 10)Compute the estimated variance of the difference scores (see Slide 14) Compute the standard error of the mean difference (see Slide 15) Compute the t obtained (see Slide 16) Identify the t critical using the charts provided in class (see Slide 17) Compare the t obtained to the t critical to...

1. WHICH OF YOUR genotypes were you able to better determine after consideration of phenotypes of...

1. WHICH OF YOUR genotypes were you able to better determine after consideration of phenotypes of your parent and siblings? 2. WHY DON’T RECESSIVE traits always eventually disappear from populations? 3. WHAT FRACTION OF recessive alleles are “hidden” in heterozygotes for each of the eight single-gene traits that you studied? 4. HOW MANY GENERATIONS would it take to eliminate at least 95% of the alleles for the recessive gene for the inability to taste PTC is a tyrant eliminated those...

After using a GC/MS, what additional experiment or experiments could you do in order to determine...

After using a GC/MS, what additional experiment or experiments could you do in order to determine the concentration of each compound in the unknown?

After Carrying out the Aspirin synthesis experiment, Suggest an experiment or technique based on what you...

After Carrying out the Aspirin synthesis experiment, Suggest an experiment or technique based on what you have learned in the last few weeks to confirm the preparation of Aspirin. (Give full details) Hint: You are provided with pure sample of Aspirin

You design a microarray experiment to determine the difference in gene expression patterns between normal and...

You design a microarray experiment to determine the difference in gene expression patterns between normal and cancerous lung tissue from humans. You label the cDNA derived from a lung tumor with a red fluorescent dye and the cDNA derived from normal lung tissue with a green fluorescent dye. You hybridize the cDNA to a microarray chip in which each spot corresponds to a DNA sequence from a different human gene. a. What can you infer about a particular gene’s expression...

Suppose that, after completing your MBA, you are offered a job as a management consultant in...

Suppose that, after completing your MBA, you are offered a job as a management consultant in a firm specialized in engagement and productivity. One of your first assignments is related to the education sector. specifically working with a large university. The overall goal of the project you're managing is to identify and enhance motivational factors of students in a well-known university. The purpose is to help improve student motivation and learning engagement to help students reach their goal of degree...

In what company and role will you be working in after completing your masters. How will...

In what company and role will you be working in after completing your masters. How will the program contribute to your personal and professional goals? (Finance management class)

Question