Question

In: Physics

why self-induction occurs 3. definition of inductance 4. inductance of a solenoid 5. self-induction in circuits...

why self-induction occurs

3. definition of inductance

4. inductance of a solenoid

5. self-induction in circuits with an inductor

why current is induced in the inductor ?

Why mutual induction occurs?

3. definition of mutual inductance

definition of capacitive reactance

definition of inductive reactance.

definition of impedance

Solutions

Expert Solution

#Self inductance is defined as the induction of a voltage in a current-carrying wire when the current in the wire itself is changing. In the case of self-inductance, the magnetic field created by a changing current in the circuit itself induces a voltage in the same circuit.

#Inductance is a property of an electrical conductor which opposes a change in current.It does that by storing and releasing energy from a magnetic field surrounding the conductor when current flows.

#Inductance of a solenoid - A solenoid is a long, thin coil; i.e., a coil whose length is much greater than its diameter. Under these conditions, and without any magnetic material used, the magnetic flux density B within the coil is practically constant and is given by

where ? is the magnetic constant, N the number of turns, i he current and l the length of the coil. Ignoring end effects, the total magnetic flux through the coil is obtained by multiplying the flux density B by the cross-section area A.

When this is combined with the definition of inductance , it follows that the inductance of a solenoid is given by:

Therefore, for air-core coils, inductance is a function of coil geometry and number of turns, and is independent of current.

#When the current flowing through an inductor changes, the time-varying magnetic field induces an electromotive force (e.m.f.) in the conductor, described by Faraday's law of induction. According to Lenz's law, the induced voltage has a direction which opposes the change in current that created it. Induced current is associated with this induced emf or ?electromotive force?.

#Mutual Inductance between the two coils is defined as the property of the coil due to which it opposes the change of current in the other coil.

#When the current in the neighboring coil is changing, the flux sets up in the coil and because of this changing flux emf is induced in the coil called Mutually Induced emf and the phenomenon is known as Mutual Inductance.

#?As the capacitor charges or discharges, a current flows through it which is restricted by the internal impedance of the capacitor. This internal impedance is commonly known as Capacitive Reactance.


#An inductors electrical resistance when used in an AC circuit is called Inductive Reactance.It is the property in an AC circuit which opposes the change in the current.?


#The opposition to current flowing through a coil in an AC circuit is determined by the AC resistance, more commonly known as Impedance (Z), of the circuit.


.


Related Solutions

The mutual inductance between a long insulated coil wrapped around a solenoid is 4.0 x 10-4...
The mutual inductance between a long insulated coil wrapped around a solenoid is 4.0 x 10-4 H. If the current in the solenoid drops at a constant rate from 15.0 A to zero in 0.076 s, what is the magnitude of the emf induced in the coil?
Write a 3-4 paragraphs report about electric circuits submit it (why do we use circuits) typed...
Write a 3-4 paragraphs report about electric circuits submit it (why do we use circuits) typed please
[4 5 5 2 4 4 6 3 3 7 5 3 6 3 4 4...
[4 5 5 2 4 4 6 3 3 7 5 3 6 3 4 4 6 5 4 5 3 7 5 5 4 2 6 5 6 6] This is my dataset Find mean, median, mode, variance, standard deviation, coefficient of variation, range, 70th percentile, 3rdquartile of the data and skewness and define what each of these statistics measure. For example, mean is a measure of the central tendency, what about the rest? Use Chebyshev’s rule to find...
[4 5 5 2 4 4 6 3 3 7 5 3 6 3 4 4...
[4 5 5 2 4 4 6 3 3 7 5 3 6 3 4 4 6 5 4 5 3 7 5 5 4 2 6 5 6 6] This is my dataset Split the dataset in two equal parts. You have 30 datavalues. If you split the data in two equal parts each part will contain 15 data values.  Call the first part Y and second part X.Draw scatter plot of the 2 datasets, X being on the horizontal...
coffee tea juice 3 4 5 5 4 3 4 4 4 5 1 2 4...
coffee tea juice 3 4 5 5 4 3 4 4 4 5 1 2 4 2 2 Do a One-way ANOVA by hand (at least once in your life!) …Is there a difference in attention for those who drink coffee, tea, or juice during an 8 a.m. class? Utilize the five steps of hypothesis testing to analyze the following data (p<.01). Attention Ratings (1=no attention- 5=full attention)
5. Without using the method of mathematical induction, prove that 5^n − 3^n + 2n is...
5. Without using the method of mathematical induction, prove that 5^n − 3^n + 2n is divisible by 4 for all natural n.
9. If the following mutation occurs in COVID19 RNA 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC…. 3’ to 5’ GGGUACAUGGUAGCCCCCGUCGCCCCGUAGAAAACACCC…. 3’,...
9. If the following mutation occurs in COVID19 RNA 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC…. 3’ to 5’ GGGUACAUGGUAGCCCCCGUCGCCCCGUAGAAAACACCC…. 3’, what most likely would be the outcome of such a change in its sequence: A frameshift mutation effect A silent mutation effect No effect resulted from the mutation A nonsense mutation effect A missense mutation effect 10.To conduct molecular analyses of COVID19 RNA sequence, which of the following biotechnology should be used to amplify samples of RNA: RNA Recombinant Plasmid Duplication RNA Fingerprinting Replication...
X 1 3 5 3 4 4 Y 2 5 4 3 4 6 A: Plot...
X 1 3 5 3 4 4 Y 2 5 4 3 4 6 A: Plot the date B: find the line of best fit C: determine ŷ AT x=3 D: Find r and r^2 E: explain r and r^2
5 + (3 * 4)^2 - 2 = 147             (5 + 3) * 4^2 -...
5 + (3 * 4)^2 - 2 = 147             (5 + 3) * 4^2 - 2 = 126             (5 + 3 )* (4^2 – 2) = 112             5 + (3 * 4^2) - 2 = 51 Which is the correct answer to using the "order of precedence" and why?
Given ?(?) = sqrt(3 + ? ) + 4. Use the definition of 4.4.3 to evaluate...
Given ?(?) = sqrt(3 + ? ) + 4. Use the definition of 4.4.3 to evaluate each of the area in the range [0, 6] if ? = 4. a) Find the area under the curve when ?? ∗ is the left endpoint of the subinterval. b) Find the area under the curve when ?? ∗ is the midpoints of the subinterval. c) Find the area under the curve when ?? ∗ is the right endpoint of the subinterval.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT