Question

1. Explain how RNAi could be used to treat disease.

2. What are two specific ways in which RNAi can block the production of proteins.

3. RNAi exerts its effect by mainly controlling which process?

a. Termination

b. Translation

c. Transcription

d. Replication

e. Splicing

4. Which of the following is not true about miRNA?

a. One miRNA may match multiple targets

b. miRNA is used by scientist as a therapy

c. miRNA is found in plants and animals

d. miRNA is a product of a gene

5. An RNA molecule that loops to base pair with itself is called a.............. RNA because of its characteristic shape.

6. Suppose that you wish to target a gene using siRNA. The sense strand of the gene that is the DNA strand codes for the mRNA contains 21 base sequence: 5' TCGGAGCAAATAGGTAGGCA 3' What would be the most appropriate 21 base guide strand sequence that would target the mRNA?

Answer 1

1. RNAi, is thought to be a natural defense mechanism that has evolved for the protection of organisms from RNA viruses. Cells can recognize double stranded RNA (dsRNA) as an intruder. When this happens, the enzyme Dicer is recruited to cut the foreign RNA into smaller pieces called siRNA. These RNA pieces consist of approximately 22 nucleotides in length. One strand of the siRNA then binds to a target viral mRNA in a sequence-specific manner. This creates a signal for the destruction of the mRNA, thereby interfering with the further production of the viral proteins needed for a virus to replicate. To put it in other words, the RNA interference mechanism interferes with the expression of a particular gene that shares a sequence with the dsRNA that is homologous to that gene using certain fragments of double-stranded RNA to achieve this

2. A targeted gene silencing strategy blocks production of the dysfunctional huntingtin (Htt) protein, the cause of Huntington's disease, a fatal, inherited neurodegenerative disorder. The effectiveness of this RNA interference (RNAi) approach in reducing levels of mutant Htt protein

3. RNAi exerts its effect by mainly controlling the trans cription process.

4. miRNA is product of gene, this statement is not true about miRNA.